View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12787_low_25 (Length: 262)
Name: NF12787_low_25
Description: NF12787
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12787_low_25 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 1 - 209
Target Start/End: Original strand, 46733199 - 46733407
Alignment:
| Q |
1 |
ccttttcatacgttgcttcatcatcgttattattgttattattatcgttattttcgttaagattatgannnnnnncctgatcgtttgaagtgattattat |
100 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
46733199 |
ccttttcatatgttgcttcatcatcgttattattgttattattatcgttattttcgttaagattatgatttttttcctgatcgtttgaagtgattattat |
46733298 |
T |
 |
| Q |
101 |
atcaaactatttttcgataagtgtttatattagggttagggtttcatgtgtgttttttctcgcttgcatgcagcttttatcaacgttttagaaattgatc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
46733299 |
atcaaactatttttcgataagtgtttatattagggttagggtttcatgtgtgttttttctcgcttgcatgcagcttttatcaacgtttttgaaattgatc |
46733398 |
T |
 |
| Q |
201 |
ccgtttaaa |
209 |
Q |
| |
|
||||||||| |
|
|
| T |
46733399 |
ccgtttaaa |
46733407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University