View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12787_low_26 (Length: 254)
Name: NF12787_low_26
Description: NF12787
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12787_low_26 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 141; Significance: 5e-74; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 141; E-Value: 5e-74
Query Start/End: Original strand, 16 - 240
Target Start/End: Original strand, 27430621 - 27430852
Alignment:
| Q |
16 |
ttatttccaatgaaattttcttcaatatttgtaaaacatgacactatgttctctcnnnnnnnncaacattcaaattttatcgcatcaagttggattgacn |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
27430621 |
ttatttccaatgaaattttcttcaatatttgtaaaacatgacactatgttctctctcaaaaa-caacattcaaattttatcgcatcaagttggattgact |
27430719 |
T |
|
| Q |
116 |
nnnnnnaaagcatattttttgaaagtgaacaaaccctttctcttgttaaaatgatgaaaatttgtataattgtcgttaatatttgtaacaaca----ttt |
211 |
Q |
| |
|
|||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
27430720 |
ttttttaaagcatattttttgaaattgaacaaacactttctcttgttaaaatgatgaaaatttgtataattgtcgttaatatttgtaacaacaatttttt |
27430819 |
T |
|
| Q |
212 |
ttta----ttttatttcaaagtttgcatccatt |
240 |
Q |
| |
|
|||| ||||||||||||||||||||||||| |
|
|
| T |
27430820 |
tttaatttttttatttcaaagtttgcatccatt |
27430852 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University