View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12787_low_30 (Length: 245)
Name: NF12787_low_30
Description: NF12787
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12787_low_30 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 9 - 245
Target Start/End: Original strand, 45201234 - 45201472
Alignment:
| Q |
9 |
tcgttcactgtcttcactctctat--ctactcttcttaacaacccaatctacttcaaattaacacagcaaccaccacatatctcaccggagacggacgaa |
106 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45201234 |
tcgttcactgtcttccctctctatatctactcttcttaacaacccaatctacttcaaattaacacagcaaccaccacatatctcaccggagacggacgaa |
45201333 |
T |
|
| Q |
107 |
aatggaagaggttccgccaccggaggtccagataaacggcggagcaacaactgcagtaacactacccccttccgaacctcatggatcgaagcggcaacgc |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45201334 |
aatggaagaggttccgccaccggaggtccagataaacggcggagcaacaactgcagtaacactacccccttccgaacctcatggatcgaagcggcaacgc |
45201433 |
T |
|
| Q |
207 |
cgacccagcgtccgattaggcgatatcggagaccaaccc |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45201434 |
cgacccagcgtccgattaggcgatatcggagaccaaccc |
45201472 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University