View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12787_low_36 (Length: 223)
Name: NF12787_low_36
Description: NF12787
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12787_low_36 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 134; Significance: 7e-70; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 21 - 212
Target Start/End: Complemental strand, 3076118 - 3075922
Alignment:
| Q |
21 |
acactacaaagaaatacatgacaagttagagttattattnnnnnnnnn-----gttagttattatagcaaacccaaacttacagtgaatacttattgcga |
115 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||| ||||||| ||||| |
|
|
| T |
3076118 |
acactacaaagaaatacatgacaacttagagttattattcgttcaaaaaaaaagttagttattatagcaaacccaaacttacagtggatacttactgcga |
3076019 |
T |
 |
| Q |
116 |
ttaagctcgtatgattgtagcataattgtttaaaattgccttaagattttgagttaaagtgtcgtgtccaactcaatcgtgtggttgctctgtgctc |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
3076018 |
ttaagctcgtatgattgtagcataattgtttaaaattgccttaagattttgagttaaagtgtcgtgtccaactcaatcgtgtggttgctctgagctc |
3075922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 152 - 207
Target Start/End: Original strand, 2336706 - 2336761
Alignment:
| Q |
152 |
tgccttaagattttgagttaaagtgtcgtgtccaactcaatcgtgtggttgctctg |
207 |
Q |
| |
|
||||||||||||||| ||||| ||| |||||||||||| | |||||||||||||| |
|
|
| T |
2336706 |
tgccttaagattttgggttaagatgtggtgtccaactcacttgtgtggttgctctg |
2336761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University