View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12787_low_37 (Length: 204)
Name: NF12787_low_37
Description: NF12787
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12787_low_37 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 99; Significance: 5e-49; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 67 - 195
Target Start/End: Original strand, 43013858 - 43013992
Alignment:
| Q |
67 |
gagtgaggttccattttgctccctcgcaatctttagaaaaacacttcctaggtttagtttaattaaatactt---ctctctcttttagaga---ggtggt |
160 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||| |
|
|
| T |
43013858 |
gagtgaggttccattttgctccctcacaatctttagaaaaacacttcctaggtttagtttaattaaatacttctcctctctcttttagagaggtggtggt |
43013957 |
T |
|
| Q |
161 |
ttatggtagatttggtgatgatgattcttcttctc |
195 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||| |
|
|
| T |
43013958 |
ttacggtagatttggtgatgatgattcttcttctc |
43013992 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 147 - 194
Target Start/End: Complemental strand, 42818315 - 42818268
Alignment:
| Q |
147 |
tttagagaggtggtttatggtagatttggtgatgatgattcttcttct |
194 |
Q |
| |
|
|||||||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
42818315 |
tttagagaggtgatttatggtagacttggtgatgatgattcttcttct |
42818268 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 18 - 47
Target Start/End: Original strand, 43013817 - 43013846
Alignment:
| Q |
18 |
ttaactgttaaactaaagtataggaagtaa |
47 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
43013817 |
ttaactgttaaactaaagtataggaagtaa |
43013846 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 159 - 195
Target Start/End: Original strand, 26011792 - 26011828
Alignment:
| Q |
159 |
gtttatggtagatttggtgatgatgattcttcttctc |
195 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||| |
|
|
| T |
26011792 |
gtttattgtagatttggtgatgatgattcttcttctc |
26011828 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University