View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12788_high_2 (Length: 369)
Name: NF12788_high_2
Description: NF12788
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12788_high_2 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 118 - 351
Target Start/End: Original strand, 54555609 - 54555842
Alignment:
| Q |
118 |
atcgatcactgtgtgtcttttaagttgtgagatttatgttttaatgtcttcttattgtctataccaaccactactttactccacttcaccacactctaac |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54555609 |
atcgatcactgtgtgtcttttaagttgtgagatttatgttttaatgtcttcttattgtctataccaaccactactttactccacttcaccacactctaac |
54555708 |
T |
|
| Q |
218 |
ccaagtgccnnnnnnnncttactacagcttatttgagtttatttaccaacttaaattttgtaagattgtttaagaaaatattccgtctcgatctatattt |
317 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54555709 |
ccaagtgcctttttttttttactacaacttatttgagtttatttaccaacttaaattttgtaagattgtttaagaaaatattccgtctcgatctatattt |
54555808 |
T |
|
| Q |
318 |
acgcaccattttaactaaaaacttatatctaaat |
351 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| |
|
|
| T |
54555809 |
acgcatcattttaactaaaaacttatatctaaat |
54555842 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University