View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12789_low_10 (Length: 237)
Name: NF12789_low_10
Description: NF12789
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12789_low_10 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 1 - 219
Target Start/End: Complemental strand, 16906045 - 16905829
Alignment:
| Q |
1 |
tctatctaaccatctctagtcattttatcaatccttttctttgccaaactcattgtttttcttgctatttttgaaacaagatttagtgcaatgagattat |
100 |
Q |
| |
|
||||||| || |||||||||||||||||||||| |||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16906045 |
tctatctcactatctctagtcattttatcaatc-ttttctttaccaaactcatt-tttttcttgctatttttgaaacaagatttagtgcaatgagattat |
16905948 |
T |
 |
| Q |
101 |
ccaagttaatattgatagttatgttcttttgccttatgttatctgcttgtgttggttccaacatgatggtaagaaagaccttgtttcatggtgcaaagaa |
200 |
Q |
| |
|
||||||| ||||||||||||||||| || ||| || |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16905947 |
ccaagttgatattgatagttatgttgttatgctttttgttctctgcttgtgttggttccaacatgatggtaagaaagaccttgtttcatggtgcaaagaa |
16905848 |
T |
 |
| Q |
201 |
gacaagtgatcagacactt |
219 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
16905847 |
gacaagtgatcagacactt |
16905829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University