View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1279-Insertion-4 (Length: 177)
Name: NF1279-Insertion-4
Description: NF1279
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1279-Insertion-4 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 166; Significance: 4e-89; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 166; E-Value: 4e-89
Query Start/End: Original strand, 8 - 177
Target Start/End: Original strand, 16068085 - 16068254
Alignment:
| Q |
8 |
acatataccttaactttctatttcttcgttacttgattggtttggtttttgatatagtatgttacttggtgttgagctaaactccatggaaaaccccctc |
107 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16068085 |
acatgtaccttaactttctatttcttcgttacttgattggtttggtttttgatatagtatgttacttggtgttgagctaaactccatggaaaaccccctc |
16068184 |
T |
|
| Q |
108 |
ttcatttctagggttcattttttattcattcatattgatcgaatgggggaggaaggagttgatgaacaat |
177 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16068185 |
ttcatttctagggttcattttttattcattcatattgatcgaatgggggaggaaggagttgatgaacaat |
16068254 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University