View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12790_low_2 (Length: 485)
Name: NF12790_low_2
Description: NF12790
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12790_low_2 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 458; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 458; E-Value: 0
Query Start/End: Original strand, 1 - 466
Target Start/End: Original strand, 47687871 - 47688336
Alignment:
| Q |
1 |
actacatgcaggctcagcagatgacacaacaacaacaactaatggctgcacgttcctcccttttatttgcacagcaacagcagcagcaaccttactcagc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47687871 |
actacatgcaggctcagcagatgacacaacaacaacaactaatggctgcacgttcctcccttttatttgcacagcaacagcagcagcaaccttactcagc |
47687970 |
T |
|
| Q |
101 |
ccttcaacagcaccaacttggaggcggtggaacttcaggactacacatgatgcaaagcgaagcctgtagcaatatgaacgtgggaggaggtagtagctca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
47687971 |
ccttcaacagcaccaacttggaggcggtggaacttcaggactacacatgatgcaaagcgaagcctgtagcaatatgaacgtgggaggaagtagtagctca |
47688070 |
T |
|
| Q |
201 |
acattgggttctggtggtgggtttcctgacttcatccgcggtggaggagagggtttgcacagaagtcttattggaggtagtggcaagcaacaagagattg |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47688071 |
acattgggttctggtggtgggtttcctgacttcatccgcggtggaggagagggtttgcacagaagtcttattggaggtagtggcaagcaacaagagattg |
47688170 |
T |
|
| Q |
301 |
ggatgaattcttcatctgatcaaggtcgaggcggcggtggtgatggcggcgaaaacctttacctcaaatcttctgatgatgggaactagtactcaattag |
400 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47688171 |
ggatgagttcttcatctgatcaaggtcgaggcggcggtggtgatggcggcgaaaacctttacctcaaatcttctgatgatgggaactagtactcaattag |
47688270 |
T |
|
| Q |
401 |
ctgttcagatcgaatttggtttaattagttatcttgatccaattcggatgcattttaacttttatg |
466 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47688271 |
ctgttcagatcgaatttggtttaattagttatcttgatccaattcggatgcattttaacttttatg |
47688336 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 33; Significance: 0.000000003; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 338 - 390
Target Start/End: Complemental strand, 35836358 - 35836306
Alignment:
| Q |
338 |
tggtgatggcggcgaaaacctttacctcaaatcttctgatgatgggaactagt |
390 |
Q |
| |
|
||||||||||||||||| |||||||| |||||||||| ||||||||| |||| |
|
|
| T |
35836358 |
tggtgatggcggcgaaacactttacctgaaatcttctggtgatgggaattagt |
35836306 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 12 - 58
Target Start/End: Complemental strand, 35836645 - 35836602
Alignment:
| Q |
12 |
gctcagcagatgacacaacaacaacaactaatggctgcacgttcctc |
58 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
35836645 |
gctcagcagatgacacaacaacaat---taatggctgcacgttcctc |
35836602 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University