View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12790_low_4 (Length: 329)
Name: NF12790_low_4
Description: NF12790
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12790_low_4 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 17 - 319
Target Start/End: Original strand, 17244756 - 17245065
Alignment:
| Q |
17 |
aatttttcccataagatgtcatgatctatagtgaaaaatcattgaagatgctaggcctaagtttattacctatgtcacatggcgtacgtatacacccttt |
116 |
Q |
| |
|
||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || || ||||||| |
|
|
| T |
17244756 |
aatttttcctataagatgtcatgatatatagtgaaaaatcattgaagatgctaggcctaagtttattacctatgtcacatggcata----tatacccttt |
17244851 |
T |
|
| Q |
117 |
caaaggacggccccctactacatttgatgagaaggagcatatacgtgatttcataggttttaattagatctatcatctatgttatgaatgtactctatta |
216 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
17244852 |
caaaggacggtcccctactacatttgatgagaaggagcatatacgtgatttcataggttttaattggatctatcatctatgttatgaatgtactctatta |
17244951 |
T |
|
| Q |
217 |
gatatcttgtatgctttcattacatgat------------nnnnnnntgagacaatggtttttgataatcaaacatcatccgtcgacaaaatgattttca |
304 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
17244952 |
gatatcttgtatgctttcattacatgataaaaaaaaataaaaaaatatgagacaatggtttttgataatc-aacatcatccgtcgacaaaatgattttca |
17245050 |
T |
|
| Q |
305 |
atggtcagacctatg |
319 |
Q |
| |
|
||||||||| ||||| |
|
|
| T |
17245051 |
atggtcagatctatg |
17245065 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University