View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12790_low_9 (Length: 223)
Name: NF12790_low_9
Description: NF12790
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12790_low_9 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 153; Significance: 3e-81; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 1 - 169
Target Start/End: Complemental strand, 13120219 - 13120051
Alignment:
| Q |
1 |
ttaattttatttcacaacatgaactcttgtgtaaacagattttcaacatgcctatggaaacacaaataacttgttaatttaagcgcttacaagttacgac |
100 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13120219 |
ttaattttatttcacaacatgaacacttgtgtaaacagattttcaacatgcatatggaaacacaaataacttgttaatttaagcgcttacaagttacgac |
13120120 |
T |
 |
| Q |
101 |
ataaacactgacataataagttgttattgaataagtatttgattaagctcttcactcaaatatctacac |
169 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13120119 |
ataaacactgcaataataagttgttattgaataagtatttgattaagctcttcactcaaatatctacac |
13120051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 27 - 160
Target Start/End: Original strand, 13007280 - 13007406
Alignment:
| Q |
27 |
ttgtgtaaacagattttcaacatgcctatggaaacacaaataacttgttaatttaagcgcttacaagttacgacataaacactgacataataagttgtta |
126 |
Q |
| |
|
||||||||| ||||||| ||||||| |||||||||||||||||| | |||||||||| ||| |||||||||||||| ||||| |||||| ||| |
|
|
| T |
13007280 |
ttgtgtaaatagattttgaacatgcatatggaaacacaaataaccttttaatttaag----tac---ttacgacataaacattgacaaaataagcactta |
13007372 |
T |
 |
| Q |
127 |
ttgaataagtatttgattaagctcttcactcaaa |
160 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
13007373 |
ttgaataagtatttcattaagctcttcactcaaa |
13007406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University