View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12791_high_3 (Length: 325)
Name: NF12791_high_3
Description: NF12791
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12791_high_3 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 97; Significance: 1e-47; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 178 - 314
Target Start/End: Original strand, 45968010 - 45968147
Alignment:
| Q |
178 |
tagatccggatgattcaccacaaaatctaaaataagttgtttgctaaatgggcnnnnnnn-gaagaaatttgaacagtagggattctgcggcgagaaata |
276 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
45968010 |
tagatccgaatgattcaccacaaaatctaaaataagttgtttgccaaatgggcaaaaaaaagaagaaatttgaacagtagggattatgcggcgagaaata |
45968109 |
T |
 |
| Q |
277 |
gaatcttggccctcaatgtaaacattttctcttcctat |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45968110 |
gaatcttggccctcaatgtaaacattttctcttcctat |
45968147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 74 - 180
Target Start/End: Original strand, 45967866 - 45967973
Alignment:
| Q |
74 |
aagcataactctttaatttttcaaacaatgacggttacataaa-tcttttattacgttgggtaattatatttgtttatatgtaaaacaattttagcatga |
172 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| |||||||| ||||||||||||||||| |||| ||||||||||||||||||||||||||| ||||| |
|
|
| T |
45967866 |
aagcgtaactctttaatttttcaaacaatgacgggtacataaaatcttttattacgttggggaattgtatttgtttatatgtaaaacaattttaccatga |
45967965 |
T |
 |
| Q |
173 |
aagtgtag |
180 |
Q |
| |
|
|||||||| |
|
|
| T |
45967966 |
aagtgtag |
45967973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 23 - 94
Target Start/End: Original strand, 45967788 - 45967859
Alignment:
| Q |
23 |
agattcatgaatatgtattgttggtgtaaaaagttatttccatttacattcaagcataactctttaattttt |
94 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
45967788 |
agattcatgaatatgtattgttggtgtaaaaagttatttccatttacattcaagcataactctttatttttt |
45967859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University