View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12791_low_2 (Length: 364)
Name: NF12791_low_2
Description: NF12791
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12791_low_2 |
 |  |
|
| [»] scaffold1383 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold1383 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: scaffold1383
Description:
Target: scaffold1383; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 19 - 353
Target Start/End: Original strand, 336 - 655
Alignment:
| Q |
19 |
actatggcattcattcgatgggaaaactatgtcgatgacttgaatatgattcaatcattatttataggattttccttatgttcattgcgttgccgatcct |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
336 |
actatggcattcattcgatgggaaaactatgtcgatgacttgaatatgattcaatcattatttataggattttccttatgttcattgcgttgccgatcct |
435 |
T |
 |
| Q |
119 |
tttacatgagatgtgaannnnnnnnaatataattgattgatatgttaattttcaagagagaagagttccaatttggagattgccgttttattcttttgga |
218 |
Q |
| |
|
||||||||||||||||| ||||| ||||||| |||||||||||||||||||||| |||||||||||||||||||||||||| |||||||| || |
|
|
| T |
436 |
tttacatgagatgtgaatttgttttaatattattgattcatatgttaattttcaagagagatgagttccaatttggagattgccgtttcattcttttaga |
535 |
T |
 |
| Q |
219 |
taattaatggcctgttaatattaatcaatttatattaaatcaataatatttggcatatgattgaatgaatgacagttataattgtacatctgacactgat |
318 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
536 |
taattaatggcctgttaatatt---------------aatcaataatatttggcatatgattgaatgaatgacagttataattgtacgtctgacactgat |
620 |
T |
 |
| Q |
319 |
taggtgcgcaaagcattcaccttttgtgagtctgt |
353 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
621 |
taggtgcgcaaagcattcaccttttgtgagtctgt |
655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University