View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12791_low_8 (Length: 253)
Name: NF12791_low_8
Description: NF12791
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12791_low_8 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 1 - 242
Target Start/End: Original strand, 31785949 - 31786190
Alignment:
| Q |
1 |
agggtaattgtgtgtggcagtttcatccctcaagatgttgcaatcaagataaaaaagaaaacaaatcgaagagttgagatattggacatacaagatttga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31785949 |
agggtaattgtgtgtggcagtttcatccctcaagatgttgcaatcaagataaaaaagaaaacaaatcgaagagttgagatattggacatacaagatttga |
31786048 |
T |
 |
| Q |
101 |
gtgaaaacaatgctgaaaatatagaagaacagaaaccaagcactagcccccaaaagccaattgaaagaaatatgtttggattgatagaaacaaagagaga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31786049 |
gtgaaaacaatgctgaaaatatagaagaacagaaaccaagcactagcccccaaaagccaattgaaagaaatatgtttggattgatagaaacaaagagaga |
31786148 |
T |
 |
| Q |
201 |
aatgcctgccctcaaccatagagttcaatacacaacaaattg |
242 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
31786149 |
aatgcctgccctcaatcatagagttcaatacacaacaaattg |
31786190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University