View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12792_low_11 (Length: 294)
Name: NF12792_low_11
Description: NF12792
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12792_low_11 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 19 - 279
Target Start/End: Original strand, 46136222 - 46136467
Alignment:
| Q |
19 |
gttattgtgctgatacgagtataagcttctttgatttcattatggctatccccccaatgtcactaaattgcgtgtcatttgattttacagcattctcatt |
118 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
46136222 |
gttattgtgctgatatgagtataagcttctttgatttcattatggctatccccccaatgtc---------------atttgattttacagcattctcatt |
46136306 |
T |
|
| Q |
119 |
acctcaattttacacccttcgtgtcatgttcaatcaagcaacaaatatgcagtcgaaagtattgaagcgtaatctatataaagactaccttacttatcac |
218 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46136307 |
acctcaattttacacccttcttgtcatgttcaatcgagcaacaaatatgcagtcgaaagtattgaagcgtaatctatataaagactaccttacttatcac |
46136406 |
T |
|
| Q |
219 |
ttttattacttgatacgactggtgtacttgccctttgtggtagttgcatttagctgatgtc |
279 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46136407 |
ttttattacttgatacgactggtgtacttgccctttgtggtagttgcatttagctgatgtc |
46136467 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University