View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12792_low_16 (Length: 252)
Name: NF12792_low_16
Description: NF12792
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12792_low_16 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 9 - 252
Target Start/End: Original strand, 54033441 - 54033688
Alignment:
| Q |
9 |
agcagagagcaagatggagccctgatgactaaaatactgatagtttg----ggtgaacnnnnnnnnnaaaggagttttggtgaaacctgatcactctcga |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
54033441 |
agcagagagcaagatggagccctgatgactaaaatactgatagtttgcatgggtgaactttttttttaaaggagttttggtgaaacctgataactctcga |
54033540 |
T |
 |
| Q |
105 |
tcaatttgaagaaacgaaaagaggatcaagtatcatcttaaagaacatagcattaattagtttctttcatcaaaacatctaatgaaaagaaagcgaaatt |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54033541 |
tcaatttgaagaaacgaaaagaggatcaagtatcatcttaaagaacatagcattaattagtttctttcatcaaaacatctaatgaaaagaaagcgaaatt |
54033640 |
T |
 |
| Q |
205 |
ttgtcttgggaaaaaatacgagttaatttcaattattagcacccaaat |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54033641 |
ttgtcttgggaaaaaatacgagttaatttcaattattagcacccaaat |
54033688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University