View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12792_low_6 (Length: 392)
Name: NF12792_low_6
Description: NF12792
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12792_low_6 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 362; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 362; E-Value: 0
Query Start/End: Original strand, 14 - 379
Target Start/End: Original strand, 45832439 - 45832804
Alignment:
| Q |
14 |
gatggacatctatcactaattgaacttgtcctgcagctgaagttattggtacataacagcaagcttgaacacatgggagatgcgtctcatggtcgagatg |
113 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45832439 |
gatgtacatctatcactaattgaacttgtcctgcagctgaagttattggtacataacagcaagcttgaacacatgggagatgcgtctcatggtcgagatg |
45832538 |
T |
|
| Q |
114 |
ctaattggaaacaagaagctaccattgaatcagggcatcttggaaagcagaagcagaaagaatcaatttttgctgttgatgtagaaatgttaagtatttc |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45832539 |
ctaattggaaacaagaagctaccattgaatcagggcatcttggaaagcagaagcagaaagaatcaatttttgctgttgatgtagaaatgttaagtatttc |
45832638 |
T |
|
| Q |
214 |
ggctgggctaggagatggagttgatggtatggttcaggtgcagtcaattttctctgaaaatgctcgtataggagtactccttgaaggacttatgctttgc |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45832639 |
ggctgggctaggagatggagttgatggtatggttcaggtgcagtcaattttctctgaaaatgctcgtataggagtactccttgaaggacttatgctttgc |
45832738 |
T |
|
| Q |
314 |
ttcaacggggctaggatcctcaagagtagtcgaatgcaaatttcacgaattcccagtgtctctgct |
379 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45832739 |
ttcaacggggctaggatcctcaagagtagtcgaatgcaaatttcacgaattcccagtgtctctgct |
45832804 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 80; Significance: 2e-37; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 179 - 366
Target Start/End: Complemental strand, 28128882 - 28128695
Alignment:
| Q |
179 |
atttttgctgttgatgtagaaatgttaagtatttcggctgggctaggagatggagttgatggtatggttcaggtgcagtcaattttctctgaaaatgctc |
278 |
Q |
| |
|
||||||||||||||||| |||||||| | ||| || ||||||||||||||||||||||| | ||||||||| |||||||||||||||||||| |||||| |
|
|
| T |
28128882 |
atttttgctgttgatgttgaaatgttgaatatatctgctgggctaggagatggagttgaagctatggttcaagtgcagtcaattttctctgagaatgcta |
28128783 |
T |
|
| Q |
279 |
gtataggagtactccttgaaggacttatgctttgcttcaacggggctaggatcctcaagagtagtcgaatgcaaatttcacgaattcc |
366 |
Q |
| |
|
|||||||||| || |||||||||| ||| | || || ||||| || ||| | ||||||||| | |||||||||||||||||||| |
|
|
| T |
28128782 |
gtataggagtgctatttgaaggactaatgatcaattttaatggggccagaatcttgaagagtagtaggatgcaaatttcacgaattcc |
28128695 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University