View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12793_low_10 (Length: 230)
Name: NF12793_low_10
Description: NF12793
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12793_low_10 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 18 - 214
Target Start/End: Complemental strand, 44746251 - 44746061
Alignment:
| Q |
18 |
aagaaaatcaagatccgcgttattaacagtaacactagctctacaaggtggccaaaatccatccacttcaacattcccttctttacgtttgactctcaac |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44746251 |
aagaaaatcaagatccgcgttattaacagtaacacta------cagggtggccaaaatccatccacttcaacattcccttctttacgtttgactctcaac |
44746158 |
T |
|
| Q |
118 |
aatttatttatttccccctaaaatcatataaatagcacccaacactctcatagttttgatatttttaatgagaaattagtaaagagtaagaagaaaa |
214 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44746157 |
aatttatttattttcccctaaaatcatataaatagcacccaacactctcatagttttgatatttttaatgagaaattagtaaagagtaagaagaaaa |
44746061 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University