View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12793_low_6 (Length: 322)
Name: NF12793_low_6
Description: NF12793
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12793_low_6 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 282; Significance: 1e-158; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 282; E-Value: 1e-158
Query Start/End: Original strand, 17 - 310
Target Start/End: Complemental strand, 25106440 - 25106147
Alignment:
| Q |
17 |
ctgtcgtgttgccctgttttatctttttagctactgtcagcactaacctccatttatgattgttattcgatccttccaccaactggtctatcatctgagc |
116 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
25106440 |
ctgtcgtgttgccctgttttttctttttagctactgtcagcactaacctccatttatgattgttatttgatccttccaccaactggtctatcatctgagc |
25106341 |
T |
|
| Q |
117 |
accaaaactgaagagctcattgcactcagtcacatccaatgttgcaaagcaaagtttctgctcgtgtgagtcataggccacgtcccgctgaccattcacc |
216 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25106340 |
accaacactgaagagctcattgcactcagtcacatccaatgttgcaaagcaaagtttctgctcgtgtgagtcataggccacgtcccgctgaccattcacc |
25106241 |
T |
|
| Q |
217 |
ttgactcgagtctcttttgacacttcagaccctccgctttctgctctgcaccagtaatgtcctagttgtagcatatgtagtgcaggtttgttct |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25106240 |
ttgactcgagtctcttttgacacttcagaccctccgctttctgctctgcaccagtaatgtcctagttgtagcatatgtagtgcaggtttgttct |
25106147 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University