View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12794_low_5 (Length: 307)
Name: NF12794_low_5
Description: NF12794
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12794_low_5 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 263; Significance: 1e-146; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 263; E-Value: 1e-146
Query Start/End: Original strand, 18 - 300
Target Start/End: Original strand, 44451711 - 44451992
Alignment:
| Q |
18 |
gttctcgcccaagaacaagattcttggtagttgtcttcttcataaatgtgttcttgtggctgtgacaaaaatcctttttagagaaggttgtgcctccaac |
117 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
44451711 |
gttctcgcccaagaacaagattcttggtggttgtcttcttcataaatgtgttcttgtggctgtgacaaaa-tcctttttagagaaggttgtgcctccaac |
44451809 |
T |
 |
| Q |
118 |
ttgttcgactcacccaaaactcgtaggttagtgttctctccctccattgttggcacctcgtaacaaacaccgtttccctctctaattgttctgatcagat |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
44451810 |
ttgttcgactcacccaaaactcgtaggttagtgttctctccctccattgttggcacctcgtaacaaccaccgtttccctctctaattgttctgatcagat |
44451909 |
T |
 |
| Q |
218 |
ctgtggaaaatgaatctcaatttggatcttggttttcttcatgctaagaatgaaaccaaatcattgtctcatcatctgtgctc |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
44451910 |
ctgtggaaaatgaatctcaatttggatcttggttttcttcatgctaagaatgaaaccaaatcattgtctcatcatccgtgctc |
44451992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University