View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12794_low_9 (Length: 248)
Name: NF12794_low_9
Description: NF12794
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12794_low_9 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 127; Significance: 1e-65; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 24 - 178
Target Start/End: Complemental strand, 52513087 - 52512933
Alignment:
| Q |
24 |
gtttcttctttatccagtaccacatcctatagagttgttggaggaaccaccacccactcttggaccccaaacatcactttgtaagtcacttcttagtttt |
123 |
Q |
| |
|
||||||||||||||||||||| ||||||||| ||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52513087 |
gtttcttctttatccagtaccccatcctatacagttggaggaaccaccaccacccactcttggaccccaaacatcactttgtaagtcacttcttagtttt |
52512988 |
T |
 |
| Q |
124 |
aattatttcctatatatatgcatgaagctaattttttcatttcttctcaatctct |
178 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52512987 |
aattatttcctatatatatgcatgaagctaattttttcatttcttctcaatctct |
52512933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University