View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12795_low_14 (Length: 246)
Name: NF12795_low_14
Description: NF12795
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12795_low_14 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 146; Significance: 5e-77; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 93 - 242
Target Start/End: Complemental strand, 28647640 - 28647491
Alignment:
| Q |
93 |
gagccagtagttaatagaaaccaacttaaaacatgagttttttaagacaatttgaaactgtccggcttaaaaggtgtttaatggatcatctccttgccat |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28647640 |
gagccagtagttaatagaaaccaacttaaaacatgagttttttaagacaatttgaaactgtccggcttaaaaggtgtttaatggatcatctccttgccat |
28647541 |
T |
 |
| Q |
193 |
cattctcttcttctccctccttttctaatttgtgtctattcatctctctc |
242 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
28647540 |
cattctcttcttctccctccttttctaatttgtgtctatccatctctctc |
28647491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University