View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12795_low_7 (Length: 351)
Name: NF12795_low_7
Description: NF12795
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12795_low_7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 189; Significance: 1e-102; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 74 - 339
Target Start/End: Original strand, 5515782 - 5516048
Alignment:
| Q |
74 |
ctgaagtttctcttcatgtcnnnnnnntgtatcacatgattgaatcagcataatgtcaccccctaagattgtcaaaccagaaaatgatcctaaatctacg |
173 |
Q |
| |
|
||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||| |
|
|
| T |
5515782 |
ctgaagtttatcttcatgtcaaaaaaatgtatcacatgattgaatcagcataatgtcaccccctaagattgtcaaaccagataatgatcctgaatctacg |
5515881 |
T |
|
| Q |
174 |
tacaaaattcacttaccaaaggtcatgtgttgaaacacctcaagatcatatggaagagttgagaggaaagtattgacacattttgaatg----tagggag |
269 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
5515882 |
tacaaaattcacttaccaaaggtca-atgttgaaacacctcaaga--aaatggaagagttgagaggaaagtattgacacattttgaatgtagctagggag |
5515978 |
T |
|
| Q |
270 |
gactgttttgtttcaatctaaattgccaagtcttttttggtcttatgttgttcttcatgcaggttttctt |
339 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
5515979 |
gactgttttgtttcaatctaaattgccaagtcttttttggtcttatgttgttcttcatgcagtttttctt |
5516048 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 15 - 76
Target Start/End: Original strand, 5515697 - 5515759
Alignment:
| Q |
15 |
actaaacactcatgtttaatcaa-taaagatcattctttcattcaatgtcatggactcgcctg |
76 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5515697 |
actaaacactcatgtttaatcaaataaagatcattctttcattcaatgtcatggactcgcctg |
5515759 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University