View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12796_low_12 (Length: 229)
Name: NF12796_low_12
Description: NF12796
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12796_low_12 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 19 - 210
Target Start/End: Complemental strand, 985534 - 985343
Alignment:
| Q |
19 |
ctaccaagttcactccttcatcttcccctcttatcacctcccatttcctcaaaacttgtttgctttagtgctcacaacaatgattcccaatctcctttgc |
118 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
985534 |
ctaccaagttcactccttcatcttaccctcttatcacctcccatttcctcaaaacttgtatgctttagtgctcacaaccatgattcccaatctcctttgc |
985435 |
T |
|
| Q |
119 |
caaggtatgtcttagaatttctctattgtctcacatcatcaccctttcattttatattatacactagattttgaaattatggttgcactcac |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
985434 |
caaggtatgtcttagaatttctctattgtctcacatcatcaccctttcattttatattatacactagattttgaaattatggttgcactcac |
985343 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University