View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12796_low_14 (Length: 219)
Name: NF12796_low_14
Description: NF12796
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12796_low_14 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 175; Significance: 2e-94; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 18 - 204
Target Start/End: Complemental strand, 6037359 - 6037173
Alignment:
| Q |
18 |
ggtacaaaaatagttgatgttgatatggattatttggccgcagctgtaatcaatggcgcgatgaaataaacgctctaaatacctgatgtggccaagatca |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||| |||||||||| |
|
|
| T |
6037359 |
ggtacaaaaatagttgatgttgatatggattatttggccgcagctgtaatcaatggcgcgatgacataaacactctaaatacctgatgtagccaagatca |
6037260 |
T |
|
| Q |
118 |
aacatgtcgatggtacgatagaggaaagggtctttggagattttgcgccacgtagtgcaaaccctgggagtgcgaataagaatatca |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6037259 |
aacatgtcgatggtacgatagaggaaagggtctttggagattttgcgccacgtagtgcaaaccctgggagtgcgaataagaatatca |
6037173 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 127 - 179
Target Start/End: Complemental strand, 6052241 - 6052189
Alignment:
| Q |
127 |
atggtacgatagaggaaagggtctttggagattttgcgccacgtagtgcaaac |
179 |
Q |
| |
|
||||| ||| |||| |||||||||||||||||||||||||| || |||||||| |
|
|
| T |
6052241 |
atggtgcgaaagagaaaagggtctttggagattttgcgccatgtggtgcaaac |
6052189 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 120 - 179
Target Start/End: Complemental strand, 6040934 - 6040875
Alignment:
| Q |
120 |
catgtcgatggtacgatagaggaaagggtctttggagattttgcgccacgtagtgcaaac |
179 |
Q |
| |
|
|||||||||||| ||||||||||||| || || |||||||||||||| || |||||||| |
|
|
| T |
6040934 |
catgtcgatggtgtgatagaggaaaggatcctttgagattttgcgccatgtggtgcaaac |
6040875 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 120 - 179
Target Start/End: Complemental strand, 6045565 - 6045506
Alignment:
| Q |
120 |
catgtcgatggtacgatagaggaaagggtctttggagattttgcgccacgtagtgcaaac |
179 |
Q |
| |
|
|||||||||||| ||||||||||||| || || |||||||||||||| || |||||||| |
|
|
| T |
6045565 |
catgtcgatggtgtgatagaggaaaggatcctttgagattttgcgccatgtggtgcaaac |
6045506 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University