View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12796_low_4 (Length: 327)
Name: NF12796_low_4
Description: NF12796
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12796_low_4 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 310; Significance: 1e-175; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 310; E-Value: 1e-175
Query Start/End: Original strand, 7 - 316
Target Start/End: Original strand, 34331535 - 34331844
Alignment:
| Q |
7 |
agagattataagctcttctaatttttgacacctgttattgctattattactcaatgtcatatcatatgctattatatttatacaagttatgcacgttgtc |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34331535 |
agagattataagctcttctaatttttgacacctgttattgctattattactcaatgtcatatcatatgctattatatttatacaagttatgcacgttgtc |
34331634 |
T |
 |
| Q |
107 |
caaatcattgtctttgaatgataaaataatgttaggtctatgtcactcgcagcttccataaatcacaagactctagaacaatgaagtttactattacaaa |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34331635 |
caaatcattgtctttgaatgataaaataatgttaggtctatgtcactcgcagcttccataaatcacaagactctagaacaatgaagtttactattacaaa |
34331734 |
T |
 |
| Q |
207 |
gaccaaaatttgccggaatcactttttcccttgaacggattgtttcccaacttgatttatggctatttctcacattctgttcttatttaccaaattggtt |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34331735 |
gaccaaaatttgccggaatcactttttcccttgaacggattgtttcccaacttgatttatggctatttctcacattctgttcttatttaccaaattggtt |
34331834 |
T |
 |
| Q |
307 |
ttctcttcat |
316 |
Q |
| |
|
|||||||||| |
|
|
| T |
34331835 |
ttctcttcat |
34331844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University