View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12796_low_5 (Length: 301)
Name: NF12796_low_5
Description: NF12796
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12796_low_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 18 - 282
Target Start/End: Complemental strand, 985607 - 985343
Alignment:
| Q |
18 |
atttttactttcatttatcgnnnnnnnagttacttttggcgattagtgtaacatttttccatggtcaatgtatctaccaagttcactccttcatcttccc |
117 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
985607 |
atttttactttcatttatcgttttgttagttacttttggcgattagtgtaacatttttccatggtcaatgtatctaccaagttcactccttcatcttacc |
985508 |
T |
 |
| Q |
118 |
ctcttatcacctcccatttcctcaaaacttgtttgctttagtgctcacaacaatgattcccaatctcctttgccaaggtatgtcttagaatttctctatt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
985507 |
ctcttatcacctcccatttcctcaaaacttgtatgctttagtgctcacaaccatgattcccaatctcctttgccaaggtatgtcttagaatttctctatt |
985408 |
T |
 |
| Q |
218 |
gtctcacatcatcaccctttcattttatattatacactagattttgaaattatggttgcactcac |
282 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
985407 |
gtctcacatcatcaccctttcattttatattatacactagattttgaaattatggttgcactcac |
985343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University