View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12797_high_13 (Length: 354)
Name: NF12797_high_13
Description: NF12797
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12797_high_13 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 59; Significance: 6e-25; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 270 - 344
Target Start/End: Original strand, 32475268 - 32475342
Alignment:
| Q |
270 |
ggacaacttcatcaatcgttcaagttttttcatggagcttcctatcctagcaaggggaggttctatcctttcatc |
344 |
Q |
| |
|
|||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
32475268 |
ggacaacttcattaatcgttcaagtttttcgatggagcttcctatcctagcaaggggaggttttatcctttcatc |
32475342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University