View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12797_high_29 (Length: 223)
Name: NF12797_high_29
Description: NF12797
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12797_high_29 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 84; Significance: 4e-40; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 84; E-Value: 4e-40
Query Start/End: Original strand, 1 - 116
Target Start/End: Complemental strand, 50834426 - 50834313
Alignment:
| Q |
1 |
agaaggagaatagggtctgtgttgttacgttagagagagtgaggaaaagagggagtggttgtatgttgcagtggctccgtgaatacttaaaaattccaat |
100 |
Q |
| |
|
||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||| || ||||||||||| |
|
|
| T |
50834426 |
agaagaagaatagggt-tgtgttgttacgttagagagagtgaggaaaagagggagtggttgtatgttgtagtggcttcgtgaataatt-aaaattccaat |
50834329 |
T |
|
| Q |
101 |
aacaatcagatttcat |
116 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
50834328 |
aacaatcagatttcat |
50834313 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 84; E-Value: 4e-40
Query Start/End: Original strand, 1 - 116
Target Start/End: Original strand, 50841427 - 50841540
Alignment:
| Q |
1 |
agaaggagaatagggtctgtgttgttacgttagagagagtgaggaaaagagggagtggttgtatgttgcagtggctccgtgaatacttaaaaattccaat |
100 |
Q |
| |
|
||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||| || ||||||||||| |
|
|
| T |
50841427 |
agaagaagaatagggt-tgtgttgttacgttagagagagtgaggaaaagagggagtggttgtatgttgtagtggcttcgtgaataatt-aaaattccaat |
50841524 |
T |
|
| Q |
101 |
aacaatcagatttcat |
116 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
50841525 |
aacaatcagatttcat |
50841540 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University