View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12797_high_5 (Length: 488)

Name: NF12797_high_5
Description: NF12797
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12797_high_5
NF12797_high_5
[»] chr6 (3 HSPs)
chr6 (259-371)||(6175291-6175403)
chr6 (402-472)||(6175198-6175268)
chr6 (31-81)||(6175405-6175456)


Alignment Details
Target: chr6 (Bit Score: 109; Significance: 1e-54; HSPs: 3)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 109; E-Value: 1e-54
Query Start/End: Original strand, 259 - 371
Target Start/End: Complemental strand, 6175403 - 6175291
Alignment:
259 tatactctacgcttaagttctgcttcataaaaaggtcaaactcaatttcgaaaattagttacgaagaagtggagaaagtgataaaatcagtacaaaaatc 358  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
6175403 tatactctacgcttaagttctgcttcataaaaaggtcaaactcaatttcgaaaattagttatgaagaagtggagaaagtgataaaatcagtacaaaaatc 6175304  T
359 caagttaatgagc 371  Q
    |||||||||||||    
6175303 caagttaatgagc 6175291  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 71; E-Value: 6e-32
Query Start/End: Original strand, 402 - 472
Target Start/End: Complemental strand, 6175268 - 6175198
Alignment:
402 aaccagtcaatattcaatggctcaacctatgtctttgcatgtttacacataaataggaaaaatgaaaataa 472  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6175268 aaccagtcaatattcaatggctcaacctatgtctttgcatgtttacacataaataggaaaaatgaaaataa 6175198  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 31 - 81
Target Start/End: Complemental strand, 6175456 - 6175405
Alignment:
31 ccgaaactgagatatcaaacaaa-gttagcaccttcaattgatggaagttag 81  Q
    ||||||||||||||||||||||| |||||||| |||||||||||||||||||    
6175456 ccgaaactgagatatcaaacaaaagttagcactttcaattgatggaagttag 6175405  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University