View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12797_low_16 (Length: 354)

Name: NF12797_low_16
Description: NF12797
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12797_low_16
NF12797_low_16
[»] chr5 (1 HSPs)
chr5 (270-344)||(32475268-32475342)


Alignment Details
Target: chr5 (Bit Score: 59; Significance: 6e-25; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 270 - 344
Target Start/End: Original strand, 32475268 - 32475342
Alignment:
270 ggacaacttcatcaatcgttcaagttttttcatggagcttcctatcctagcaaggggaggttctatcctttcatc 344  Q
    |||||||||||| ||||||||||||||||  ||||||||||||||||||||||||||||||| ||||||||||||    
32475268 ggacaacttcattaatcgttcaagtttttcgatggagcttcctatcctagcaaggggaggttttatcctttcatc 32475342  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University