View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12797_low_29 (Length: 235)
Name: NF12797_low_29
Description: NF12797
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12797_low_29 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 63 - 219
Target Start/End: Original strand, 46463816 - 46463972
Alignment:
| Q |
63 |
tggcgatgagttcagcgatttcatacgctttatcaggttcatcgtatttggattgagacatggttgaagagcgaacaagagtagcaatggctca---gtg |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
46463816 |
tggcgatgagttcagcgatttcatacgctttatcaggttcatcgtatttggattgagacatggttgaagagcgaacaagagtagcaatggctcagtggtg |
46463915 |
T |
 |
| Q |
160 |
gtttcccgctacaaagtgtagtaatgtaagcaaaacaatgatattgctcaaactgaaaat |
219 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46463916 |
gtttcccgctacaaagt---gtaatgtaagcaaaacaatgatattgctcaaactgaaaat |
46463972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University