View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12797_low_30 (Length: 232)
Name: NF12797_low_30
Description: NF12797
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12797_low_30 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 138; Significance: 3e-72; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 69 - 214
Target Start/End: Complemental strand, 34649551 - 34649406
Alignment:
| Q |
69 |
ttcttagcattaaataagaagacggtcaatgatagagttatcataacatgagaaccatttgtagaattaaatgaaagatgtttaggagcttcaactctat |
168 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
34649551 |
ttcttagcattaaataagaagacggtcaatgatagagttatcacaacatgagaaccatttgtagaattaaatgaaagatgtttaggagcttcagctctat |
34649452 |
T |
|
| Q |
169 |
caaaataaaatgaaccatataactgtcaaattgtttgagtcattgt |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34649451 |
caaaataaaatgaaccatataactgtcaaattgtttgagtcattgt |
34649406 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 165 - 197
Target Start/End: Complemental strand, 34649362 - 34649330
Alignment:
| Q |
165 |
ctatcaaaataaaatgaaccatataactgtcaa |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
34649362 |
ctatcaaaataaaatgaaccatataactgtcaa |
34649330 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 17 - 52
Target Start/End: Complemental strand, 34649610 - 34649575
Alignment:
| Q |
17 |
tgaacctattcttcaaactagtgaactgttttgttt |
52 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||| |
|
|
| T |
34649610 |
tgaacttattcttcaaactagtgaactgttttgttt |
34649575 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 116 - 185
Target Start/End: Original strand, 14489717 - 14489786
Alignment:
| Q |
116 |
atgagaaccatttgtagaattaaatgaaagatgtttaggagcttcaactctatcaaaataaaatgaacca |
185 |
Q |
| |
|
|||||||||| |||||| |||| ||||||| || || ||||||||| |||||||||||||||||| |||| |
|
|
| T |
14489717 |
atgagaaccacttgtagcattatatgaaaggtgcttgggagcttcagctctatcaaaataaaatgcacca |
14489786 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University