View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12797_low_36 (Length: 213)
Name: NF12797_low_36
Description: NF12797
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12797_low_36 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 82; Significance: 7e-39; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 82; E-Value: 7e-39
Query Start/End: Original strand, 18 - 111
Target Start/End: Complemental strand, 4396291 - 4396198
Alignment:
| Q |
18 |
ataacgagtcatattgatttaatgataaataaatttgttttcgattatcatgtgtagcttaacacactattgtttgggagtcttttggtaacca |
111 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||| |
|
|
| T |
4396291 |
ataacgagtcatattgatttaatcataaataaatttgttttcgattatcatgtgtagcttagcacactcttgtttgggagtcttttggtaacca |
4396198 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 140 - 200
Target Start/End: Complemental strand, 4396169 - 4396109
Alignment:
| Q |
140 |
gggtgatcagcttgaccttgatcatttgatgtaactatactctttttcctagttcctttgc |
200 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||| || |||||||||||| ||||| |
|
|
| T |
4396169 |
gggtgatcaacttgaccttgatcatttgatgtaactatattcgttttcctagttcttttgc |
4396109 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University