View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12797_low_5 (Length: 488)
Name: NF12797_low_5
Description: NF12797
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12797_low_5 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 109; Significance: 1e-54; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 109; E-Value: 1e-54
Query Start/End: Original strand, 259 - 371
Target Start/End: Complemental strand, 6175403 - 6175291
Alignment:
| Q |
259 |
tatactctacgcttaagttctgcttcataaaaaggtcaaactcaatttcgaaaattagttacgaagaagtggagaaagtgataaaatcagtacaaaaatc |
358 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6175403 |
tatactctacgcttaagttctgcttcataaaaaggtcaaactcaatttcgaaaattagttatgaagaagtggagaaagtgataaaatcagtacaaaaatc |
6175304 |
T |
|
| Q |
359 |
caagttaatgagc |
371 |
Q |
| |
|
||||||||||||| |
|
|
| T |
6175303 |
caagttaatgagc |
6175291 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 71; E-Value: 6e-32
Query Start/End: Original strand, 402 - 472
Target Start/End: Complemental strand, 6175268 - 6175198
Alignment:
| Q |
402 |
aaccagtcaatattcaatggctcaacctatgtctttgcatgtttacacataaataggaaaaatgaaaataa |
472 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6175268 |
aaccagtcaatattcaatggctcaacctatgtctttgcatgtttacacataaataggaaaaatgaaaataa |
6175198 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 31 - 81
Target Start/End: Complemental strand, 6175456 - 6175405
Alignment:
| Q |
31 |
ccgaaactgagatatcaaacaaa-gttagcaccttcaattgatggaagttag |
81 |
Q |
| |
|
||||||||||||||||||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
6175456 |
ccgaaactgagatatcaaacaaaagttagcactttcaattgatggaagttag |
6175405 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University