View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12797_low_8 (Length: 421)
Name: NF12797_low_8
Description: NF12797
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12797_low_8 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 249; Significance: 1e-138; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 15 - 267
Target Start/End: Complemental strand, 52603986 - 52603734
Alignment:
| Q |
15 |
gctagctgcaaatattaattagaaagggtaaggttaacactcaatgcatataaattttatttggttttgtctttgtctccctgtttgtatcccagcaaaa |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52603986 |
gctagctgcaaatattaattagaaagggtaaggttaacactcaatgcatataaattttatttggttttgtctttgtctccctgtttgtatcccagcaaaa |
52603887 |
T |
|
| Q |
115 |
gctactttttgacatgaaccatggtgctttgccattcttgtatacggtccctttctcacattgtatatctcgaggttatgttctgtacatatagtaaatt |
214 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52603886 |
gctactttttgacatcaaccatggtgctttgccattcttgtatacggtccctttctcacattgtatatctcgaggttatgttctgtacatatagtaaatt |
52603787 |
T |
|
| Q |
215 |
tttatttctatattcccttttggcaattcaacagagtcaaataacaaaaaata |
267 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52603786 |
tttatttctatattcccttttggcaattcaacagagtcaaataacaaaaaata |
52603734 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 140; E-Value: 3e-73
Query Start/End: Original strand, 264 - 403
Target Start/End: Complemental strand, 52603697 - 52603558
Alignment:
| Q |
264 |
aatagtcaatgtggatggggaaagtattgtttgtttgattcttccttttatttgtctttcactctcaatcttttggaacactttgatgatcgtttctatg |
363 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52603697 |
aatagtcaatgtggatggggaaagtattgtttgtttgattcttccttttatttgtctttcactctcaatcttttggaacactttgatgatcgtttctatg |
52603598 |
T |
|
| Q |
364 |
gaaggttcggacatacgaaaggggaagggataactagaaa |
403 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52603597 |
gaaggttcggacatacgaaaggggaagggataactagaaa |
52603558 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University