View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12798_high_1 (Length: 284)
Name: NF12798_high_1
Description: NF12798
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12798_high_1 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 256; Significance: 1e-142; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 17 - 284
Target Start/End: Original strand, 29136372 - 29136639
Alignment:
| Q |
17 |
agggagaacttaccttgtgtgtccaacaagtttcccagaggagattagtcacaatcaaactcagttgaatactttgtacgtatgatatggctataaattc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29136372 |
agggagaacttaccttgtgtgtccaacaagtttcccagaggagattagtcacaatcaaactcagttgaatactttgtacgtatgatatggctataaattc |
29136471 |
T |
 |
| Q |
117 |
actgcatgttttctcagggtagtattgtactgagtctatttatttgtgtttctttattctaattatctgactcaattgaatttcaagttttagtattatt |
216 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29136472 |
actgcatgttttctcagggtagtattgtattgagtctatttatttgtgtttctttattctaattatctgactcaattgaatttcaagttttagtattatt |
29136571 |
T |
 |
| Q |
217 |
gatctcatataacttcaccttaaagcattgatggtaattatacactgcatgttcttttatgctagttc |
284 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
29136572 |
gatctcatataacttcaccttaaagcattgatggcaattatacactgcatgttcttttatgctggttc |
29136639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University