View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12798_high_5 (Length: 216)

Name: NF12798_high_5
Description: NF12798
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12798_high_5
NF12798_high_5
[»] chr1 (1 HSPs)
chr1 (21-204)||(10257386-10257571)


Alignment Details
Target: chr1 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 21 - 204
Target Start/End: Complemental strand, 10257571 - 10257386
Alignment:
21 acaccaaccaccacagtacggccaccggaggcaccattgtaggtggtgatcattttggtgatgacacgtggcagtatctatatatgtcaa--agagagtt 118  Q
    |||||||| |||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||| | ||  ||||||||    
10257571 acaccaacaaccacagtacggccaccggaggcaccgttgtaggtggtgatcattttgatgatgacacgtggcagtatctatatatatgaatgagagagtt 10257472  T
119 ggttgatgtcgttatgttgtcggtgattggaggatgtagtgtaagtgtcggtgattatacacatgcaaccaaaaatgtcacaggtt 204  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
10257471 ggttgatgtcgttatgttgtcggtgattggaggatgtagtgtaagtgtcggtgattatacacatgcaaccaaaaatgtcacaggtt 10257386  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University