View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12799_low_4 (Length: 213)
Name: NF12799_low_4
Description: NF12799
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12799_low_4 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
| [»] scaffold0047 (1 HSPs) |
| | |
|
Alignment Details
Target: chr6 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 1 - 213
Target Start/End: Complemental strand, 30833760 - 30833549
Alignment:
| Q |
1 |
tcatgatgttgtgtttttcatccttttcaccgaaaaaagtctttaacttaataaccnnnnnnnnn-ctcctctgcaagattgttgtctttcttggttgcc |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||| |
|
|
| T |
30833760 |
tcatgatgttgtgtttttcatccttttcaccgaaaaaagtctttaacttaataaccctttttttttctcctatgcaagattgttgtctttcttggttgcc |
30833661 |
T |
|
| Q |
100 |
atttgattagttactaagattatgtatattaattgtgggtttattatgcttccaaagcacatgtttctatcaattaaatattgaattcctcttctgttat |
199 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30833660 |
atttgattagttactaggattatgtatattaattgtgggtttattatgcttctaaagcaca--tttctatcaattaaatattgaattcctcttctgttat |
30833563 |
T |
|
| Q |
200 |
gaaacaattttact |
213 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
30833562 |
gaaacaattttact |
30833549 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0047 (Bit Score: 58; Significance: 1e-24; HSPs: 1)
Name: scaffold0047
Description:
Target: scaffold0047; HSP #1
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 82 - 151
Target Start/End: Complemental strand, 61965 - 61896
Alignment:
| Q |
82 |
ttgtctttcttggttgccatttgattagttactaagattatgtatattaattgtgggtttattatgcttc |
151 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| || |||| ||||||||||||||||||||||||||| |
|
|
| T |
61965 |
ttgtctttcttggttgccatttgattagttactaggaatatgcatattaattgtgggtttattatgcttc |
61896 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University