View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1279_low_14 (Length: 252)
Name: NF1279_low_14
Description: NF1279
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1279_low_14 |
 |  |
|
| [»] chr7 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 155; Significance: 2e-82; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 94 - 252
Target Start/End: Original strand, 48159229 - 48159387
Alignment:
| Q |
94 |
gtggtatagtagcatacctgcattccttgagcaaacaagcacaagttttgagtgcatcaacagcatcagctgatggaacaatcattaaaatagaaaccag |
193 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48159229 |
gtggtatagcagcatacctgcattccttgagcaaacaagcacaagttttgagtgcatcaacagcatcagctgatggaacaatcattaaaatagaaaccag |
48159328 |
T |
 |
| Q |
194 |
tatggcaactaattggattatgcgtgaatttctccaatcttcaagaacaacaagcatcc |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48159329 |
tatggcaactaattggattatgcgtgaatttctccaatcttcaagaacaacaagcatcc |
48159387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 10 - 82
Target Start/End: Original strand, 48159132 - 48159204
Alignment:
| Q |
10 |
gcataggcggggacacctaaagagttatatgtaggtggtttagagttgaatctctgctactaacatttggcaa |
82 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
48159132 |
gcataggcagggacacctaaagagttatatgtaggtggtttagagttgaatatctgctactaacatttggcaa |
48159204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University