View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1279_low_7 (Length: 335)
Name: NF1279_low_7
Description: NF1279
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1279_low_7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 146; Significance: 7e-77; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 146; E-Value: 7e-77
Query Start/End: Original strand, 85 - 238
Target Start/End: Original strand, 4389466 - 4389619
Alignment:
| Q |
85 |
atgaactagggcatgaattgggagttattaaaacaagggaaagacacgttaagcctcctggttttagctttattggcccaacatatctgaattcccaata |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4389466 |
atgaactagggcatgaattgggagttattaaaacaagggaaagacacgttaagccttctggttttagctttattggcccaacatatctgaattcccaata |
4389565 |
T |
|
| Q |
185 |
aaaggaaaatatattcttgggttagacttgtctacttgatgcagtccactgtaa |
238 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4389566 |
aagggaaaatatattcttgggttagacttgtctacttgatgcagtccactgtaa |
4389619 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University