View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1280-Insertion-2 (Length: 123)
Name: NF1280-Insertion-2
Description: NF1280
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1280-Insertion-2 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 100; Significance: 6e-50; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 100; E-Value: 6e-50
Query Start/End: Original strand, 13 - 123
Target Start/End: Original strand, 11290404 - 11290515
Alignment:
| Q |
13 |
ttagtctatcatttcacatgaaaaatgtcaaattctgtgtaatcaagtgtttagtttaagttatgttttc-ttttgggtactaaactaccattgtcggta |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
11290404 |
ttagtctatcatttcacatgaaaaatgtcaaatactgtgtaatcaagtgtttagtttaagttatgttttctttttgggtactaaactaccattgtcggta |
11290503 |
T |
|
| Q |
112 |
gttatctatgag |
123 |
Q |
| |
|
|||||||||||| |
|
|
| T |
11290504 |
gttatctatgag |
11290515 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University