View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12800_high_6 (Length: 342)
Name: NF12800_high_6
Description: NF12800
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12800_high_6 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 142; Significance: 2e-74; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 142; E-Value: 2e-74
Query Start/End: Original strand, 1 - 150
Target Start/End: Original strand, 25527670 - 25527819
Alignment:
| Q |
1 |
aggtgaacaccgtcggacgagtcgttgctgagaacgccgactggcgggccatggcagaggcagcgtcgaggttgccggagcgaatcaatgacgtgacacg |
100 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25527670 |
aggtgaacaccgtcggacgattcgttgctgagaacgccgactggcgggccatggcagaggcagcgtcgaggttgccggagcgaatcaatgacgtgacacg |
25527769 |
T |
|
| Q |
101 |
cgtgtggagttcttcaggaggaggctggggctccgccgttgctgcttgtt |
150 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
25527770 |
cgtgtggagttcttcaggaggaggctgaggctccgccgttgctgcttgtt |
25527819 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 111; E-Value: 5e-56
Query Start/End: Original strand, 1 - 143
Target Start/End: Original strand, 25535699 - 25535841
Alignment:
| Q |
1 |
aggtgaacaccgtcggacgagtcgttgctgagaacgccgactggcgggccatggcagaggcagcgtcgaggttgccggagcgaatcaatgacgtgacacg |
100 |
Q |
| |
|
|||||||||| || |||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| || |||| || |
|
|
| T |
25535699 |
aggtgaacacagttggacgagttgttgctgagaacgtcgactggcgggccatggcagaggcagcgtcgaggttgccggagcgaatcaacgatctgacgcg |
25535798 |
T |
|
| Q |
101 |
cgtgtggagttcttcaggaggaggctggggctccgccgttgct |
143 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25535799 |
cgtgtggagttcttcaggaggaggctggggctccgccgttgct |
25535841 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 210 - 331
Target Start/End: Original strand, 25527879 - 25528000
Alignment:
| Q |
210 |
tggcgacagagtgacattgttgagtttgaaaccctaaaatttcgtactttctaatttgaaatgaaaatgaaatgaattcttctaacatctttcttcttat |
309 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25527879 |
tggcgaaagagtgacattgttgagtttgaaaccctaaaatttcgtactttctattttgaaatgaaaatgaaatgaattcttctaacatctttcttcttat |
25527978 |
T |
|
| Q |
310 |
atatactacccccagcagaatt |
331 |
Q |
| |
|
|||||||||| ||||||||||| |
|
|
| T |
25527979 |
atatactaccaccagcagaatt |
25528000 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 1 - 86
Target Start/End: Complemental strand, 25514742 - 25514657
Alignment:
| Q |
1 |
aggtgaacaccgtcggacgagtcgttgctgagaacgccgactggcgggccatggcagaggcagcgtcgaggttgccggagcgaatc |
86 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
25514742 |
aggtgaacaccgtcggacgagtcgttgctgagaacgccgactggcgggccatggcagaggcagcgttgaggttgccggagcgaatc |
25514657 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University