View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12802_low_1 (Length: 319)
Name: NF12802_low_1
Description: NF12802
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12802_low_1 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 18 - 308
Target Start/End: Complemental strand, 32907955 - 32907664
Alignment:
| Q |
18 |
acatatacaccaaggagtgacacacttgtacttccttacttcgtttcttgcacaacacacatcaattaggtctacaaaccattgcatttgaacaaaacca |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
32907955 |
acatatacaccaaggagtgacacacttgtacttccttacttcgtttcttgcacaacacacatcaattaggtctacaaaccattgcatttga-caaaacca |
32907857 |
T |
|
| Q |
118 |
tgcattgctatgaaagcagcnnnnnnnn--ttacaaccaaatnnnnnnntcataaactcatcaagcaagtgcaagaaccacagactaaatgccgcctgaa |
215 |
Q |
| |
|
||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32907856 |
tgcattgctatgaaagcaggaaaaaaaaaattacaaccaaataaaaaaatcataaactcatcaagcaagtgcaagaaccacagactaaatgccgcctgaa |
32907757 |
T |
|
| Q |
216 |
tccacaaattctttcagaaaccactttgataagaatcaacatgtggcaattaagactacagatttcaatagtgtaaagccagtagtatttcat |
308 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||| |||||||||||||||||||| |
|
|
| T |
32907756 |
tccgcaaattctttcagaaaccactttgataagaatcaacatgtggcaattaagactaaagatttcgatagtataaagccagtagtatttcat |
32907664 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University