View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12802_low_3 (Length: 241)
Name: NF12802_low_3
Description: NF12802
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12802_low_3 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 141; Significance: 5e-74; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 141; E-Value: 5e-74
Query Start/End: Original strand, 75 - 223
Target Start/End: Original strand, 46353377 - 46353525
Alignment:
| Q |
75 |
ggtctcgatcaatattggatagcaagtacaaaattgtttttaacatgtataattgaccatgttgagtaggacctaatcctccttagttaacactaattag |
174 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46353377 |
ggtctcgatcaatattggatagcaagtacaaaattgtttttaacatgtataattgaccatgttgagtaggacctaatcctccttagttaacactaattag |
46353476 |
T |
|
| Q |
175 |
caatgacgattacaatgtaaattgctgatttgacaagaagtaataataa |
223 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||| |||||||||||| |
|
|
| T |
46353477 |
caatgacgattacaatgtaaattactgatttgacaacaagtaataataa |
46353525 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University