View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12803_high_11 (Length: 344)
Name: NF12803_high_11
Description: NF12803
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12803_high_11 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 292; Significance: 1e-164; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 292; E-Value: 1e-164
Query Start/End: Original strand, 1 - 315
Target Start/End: Complemental strand, 14251285 - 14250973
Alignment:
| Q |
1 |
atctctaacaagagtgttgtcactgcttgctacaaatttctctagctgcacggactcgttggccgtagatttctcgtatgcaattgcagctaaaactagt |
100 |
Q |
| |
|
||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14251285 |
atctctaacaagagtgttgtccctgctttctacaaatttctctagctgcacggactcgttggccgtagatttctcgtatgcaattgcagctaaaactagt |
14251186 |
T |
|
| Q |
101 |
ggttgaatgtctatttcagcttcgcccataaaatcatcagttgaaaatgtatccttatcatatacaagctgcatatgtaagaaaacacaataaatctaat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14251185 |
ggttgaatgtctatttcagcttcgcccataaaatcatcagttgaaaatgtatccttatcatatacaagctgcatatgtaagaaaacacaataaatctaat |
14251086 |
T |
|
| Q |
201 |
caaacatgatcgccatttaaaatgtatcaaacaatttcaacaatagagataaattgacatctagcaaaagtacaaaggcatcggcataagtacaagagca |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
14251085 |
caaacatgatcgccatttaaaatgtatcaaacaatttcaaca--agagataaattgacatctagcaaaagtacaacggcatcggcataagtacaagagca |
14250988 |
T |
|
| Q |
301 |
aaattagtaagaaga |
315 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
14250987 |
aaattagtaagaaga |
14250973 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.000000008; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 68 - 135
Target Start/End: Original strand, 4987589 - 4987656
Alignment:
| Q |
68 |
gatttctcgtatgcaattgcagctaaaactagtggttgaatgtctatttcagcttcgcccataaaatc |
135 |
Q |
| |
|
|||||||| ||||| |||| ||| | |||| ||||||||||||||||||||| || ||||||||||| |
|
|
| T |
4987589 |
gatttctcatatgcttttgctgctgatactaatggttgaatgtctatttcagcctctcccataaaatc |
4987656 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University