View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12803_low_2 (Length: 286)
Name: NF12803_low_2
Description: NF12803
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12803_low_2 |
 |  |
|
| [»] scaffold0021 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr8 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 15)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 226 - 268
Target Start/End: Complemental strand, 11404140 - 11404098
Alignment:
| Q |
226 |
gttacaaaaattttagggtgaggggatggtgccccagtccaag |
268 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11404140 |
gttacaaaaattttagggtgaggggatggtgccccagtccaag |
11404098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 227 - 269
Target Start/End: Complemental strand, 11610418 - 11610376
Alignment:
| Q |
227 |
ttacaaaaattttagggtgaggggatggtgccccagtccaaga |
269 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11610418 |
ttacaaaaattttagggtgaggggatggtgccccagtccaaga |
11610376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 226 - 268
Target Start/End: Complemental strand, 19723450 - 19723408
Alignment:
| Q |
226 |
gttacaaaaattttagggtgaggggatggtgccccagtccaag |
268 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19723450 |
gttacaaaaattttagggtgaggggatggtgccccagtccaag |
19723408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 226 - 268
Target Start/End: Original strand, 27879553 - 27879595
Alignment:
| Q |
226 |
gttacaaaaattttagggtgaggggatggtgccccagtccaag |
268 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27879553 |
gttacaaaaattttagggtgaggggatggtgccccagtccaag |
27879595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 226 - 268
Target Start/End: Original strand, 28019734 - 28019776
Alignment:
| Q |
226 |
gttacaaaaattttagggtgaggggatggtgccccagtccaag |
268 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28019734 |
gttacaaaaattttagggtgaggggatggtgccccagtccaag |
28019776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 226 - 268
Target Start/End: Complemental strand, 29767325 - 29767283
Alignment:
| Q |
226 |
gttacaaaaattttagggtgaggggatggtgccccagtccaag |
268 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29767325 |
gttacaaaaattttagggtgaggggatggtgccccagtccaag |
29767283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 226 - 268
Target Start/End: Original strand, 11909416 - 11909458
Alignment:
| Q |
226 |
gttacaaaaattttagggtgaggggatggtgccccagtccaag |
268 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
11909416 |
gttacaaaatttttagggtgaggggatggtgccccagtccaag |
11909458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 226 - 268
Target Start/End: Complemental strand, 22711648 - 22711606
Alignment:
| Q |
226 |
gttacaaaaattttagggtgaggggatggtgccccagtccaag |
268 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
22711648 |
gttacaaaaattttaggatgaggggatggtgccccagtccaag |
22711606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 226 - 268
Target Start/End: Complemental strand, 4840279 - 4840237
Alignment:
| Q |
226 |
gttacaaaaattttagggtgaggggatggtgccccagtccaag |
268 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||| |||||||| |
|
|
| T |
4840279 |
gttacagaaattttagggtgaggggatggtgccctagtccaag |
4840237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 226 - 268
Target Start/End: Complemental strand, 36261785 - 36261743
Alignment:
| Q |
226 |
gttacaaaaattttagggtgaggggatggtgccccagtccaag |
268 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||| |||| |
|
|
| T |
36261785 |
gttacaaaaattttaaggtgaggggatggtgccccagttcaag |
36261743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 226 - 264
Target Start/End: Complemental strand, 41553424 - 41553386
Alignment:
| Q |
226 |
gttacaaaaattttagggtgaggggatggtgccccagtc |
264 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
41553424 |
gttacaaaaattttagggtgaggggatggtgctccagtc |
41553386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 236 - 268
Target Start/End: Complemental strand, 17095679 - 17095647
Alignment:
| Q |
236 |
ttttagggtgaggggatggtgccccagtccaag |
268 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
17095679 |
ttttagggtgaggggatggtgccccagtccaag |
17095647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 232 - 268
Target Start/End: Original strand, 32296638 - 32296674
Alignment:
| Q |
232 |
aaaattttagggtgaggggatggtgccccagtccaag |
268 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||| |
|
|
| T |
32296638 |
aaaattttagggtgaggggatggtgccccaatccaag |
32296674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 226 - 268
Target Start/End: Original strand, 28739554 - 28739596
Alignment:
| Q |
226 |
gttacaaaaattttagggtgaggggatggtgccccagtccaag |
268 |
Q |
| |
|
||||||||| |||||||||||||||||||||| ||||||||| |
|
|
| T |
28739554 |
gttacaaaatttttagggtgaggggatggtgctgcagtccaag |
28739596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 231 - 268
Target Start/End: Complemental strand, 43288206 - 43288169
Alignment:
| Q |
231 |
aaaaattttagggtgaggggatggtgccccagtccaag |
268 |
Q |
| |
|
||||| ||||||||||||||||||||| |||||||||| |
|
|
| T |
43288206 |
aaaaaatttagggtgaggggatggtgctccagtccaag |
43288169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 15)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 226 - 268
Target Start/End: Original strand, 245257 - 245299
Alignment:
| Q |
226 |
gttacaaaaattttagggtgaggggatggtgccccagtccaag |
268 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
245257 |
gttacaaaaattttagggtgaggggatggtgccccagtccaag |
245299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 226 - 268
Target Start/End: Original strand, 21577091 - 21577133
Alignment:
| Q |
226 |
gttacaaaaattttagggtgaggggatggtgccccagtccaag |
268 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21577091 |
gttacaaaaattttagggtgaggggatggtgccccagtccaag |
21577133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 226 - 268
Target Start/End: Complemental strand, 35109830 - 35109788
Alignment:
| Q |
226 |
gttacaaaaattttagggtgaggggatggtgccccagtccaag |
268 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35109830 |
gttacaaaaattttagggtgaggggatggtgccccagtccaag |
35109788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 226 - 268
Target Start/End: Original strand, 38265230 - 38265272
Alignment:
| Q |
226 |
gttacaaaaattttagggtgaggggatggtgccccagtccaag |
268 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
38265230 |
gttacataaattttagggtgaggggatggtgccccagtccaag |
38265272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 226 - 268
Target Start/End: Original strand, 38405147 - 38405189
Alignment:
| Q |
226 |
gttacaaaaattttagggtgaggggatggtgccccagtccaag |
268 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
38405147 |
gttacaaaatttttagggtgaggggatggtgccccagtccaag |
38405189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 226 - 268
Target Start/End: Complemental strand, 41151312 - 41151270
Alignment:
| Q |
226 |
gttacaaaaattttagggtgaggggatggtgccccagtccaag |
268 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
41151312 |
gttacaaaaaatttagggtgaggggatggtgccccagtccaag |
41151270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 226 - 268
Target Start/End: Complemental strand, 45278591 - 45278549
Alignment:
| Q |
226 |
gttacaaaaattttagggtgaggggatggtgccccagtccaag |
268 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
45278591 |
gttacaaaaattttagggtgaggggatggtgctccagtccaag |
45278549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 232 - 268
Target Start/End: Original strand, 37095209 - 37095245
Alignment:
| Q |
232 |
aaaattttagggtgaggggatggtgccccagtccaag |
268 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37095209 |
aaaattttagggtgaggggatggtgccccagtccaag |
37095245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 226 - 272
Target Start/End: Complemental strand, 12472260 - 12472214
Alignment:
| Q |
226 |
gttacaaaaattttagggtgaggggatggtgccccagtccaagacag |
272 |
Q |
| |
|
|||||| ||| ||||||||||||||||||| |||||||||||||||| |
|
|
| T |
12472260 |
gttacacaaagtttagggtgaggggatggtaccccagtccaagacag |
12472214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 236 - 268
Target Start/End: Original strand, 16059356 - 16059388
Alignment:
| Q |
236 |
ttttagggtgaggggatggtgccccagtccaag |
268 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
16059356 |
ttttagggtgaggggatggtgccccagtccaag |
16059388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 236 - 268
Target Start/End: Original strand, 18116947 - 18116979
Alignment:
| Q |
236 |
ttttagggtgaggggatggtgccccagtccaag |
268 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
18116947 |
ttttagggtgaggggatggtgccccagtccaag |
18116979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 232 - 268
Target Start/End: Complemental strand, 28407637 - 28407601
Alignment:
| Q |
232 |
aaaattttagggtgaggggatggtgccccagtccaag |
268 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||| |
|
|
| T |
28407637 |
aaaattttagggtgaggggatggtgccccaatccaag |
28407601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 232 - 268
Target Start/End: Complemental strand, 34721967 - 34721931
Alignment:
| Q |
232 |
aaaattttagggtgaggggatggtgccccagtccaag |
268 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| |
|
|
| T |
34721967 |
aaaattttagggtgaggggatggtgcccgagtccaag |
34721931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 236 - 268
Target Start/End: Complemental strand, 48176529 - 48176497
Alignment:
| Q |
236 |
ttttagggtgaggggatggtgccccagtccaag |
268 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
48176529 |
ttttagggtgaggggatggtgccccagtccaag |
48176497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 232 - 266
Target Start/End: Complemental strand, 39234896 - 39234862
Alignment:
| Q |
232 |
aaaattttagggtgaggggatggtgccccagtcca |
266 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| |
|
|
| T |
39234896 |
aaaatttttgggtgaggggatggtgccccagtcca |
39234862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 6)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 226 - 268
Target Start/End: Original strand, 35163743 - 35163785
Alignment:
| Q |
226 |
gttacaaaaattttagggtgaggggatggtgccccagtccaag |
268 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35163743 |
gttacaaaaattttagggtgaggggatggtgccccagtccaag |
35163785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 226 - 268
Target Start/End: Complemental strand, 20685464 - 20685422
Alignment:
| Q |
226 |
gttacaaaaattttagggtgaggggatggtgccccagtccaag |
268 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
20685464 |
gttacaaaaattttagggtgaagggatggtgccccagtccaag |
20685422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 227 - 268
Target Start/End: Original strand, 14505519 - 14505559
Alignment:
| Q |
227 |
ttacaaaaattttagggtgaggggatggtgccccagtccaag |
268 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
14505519 |
ttacaaaaattttagg-tgaggggatggtgccccagtccaag |
14505559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 231 - 272
Target Start/End: Complemental strand, 17948814 - 17948773
Alignment:
| Q |
231 |
aaaaattttagggtgaggggatggtgccccagtccaagacag |
272 |
Q |
| |
|
|||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
17948814 |
aaaaattttaaggtgaggggatggtgtcccagtccaagacag |
17948773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 226 - 256
Target Start/End: Original strand, 2711733 - 2711763
Alignment:
| Q |
226 |
gttacaaaaattttagggtgaggggatggtg |
256 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
2711733 |
gttacaaaaattttagggtgaggggatggtg |
2711763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 226 - 264
Target Start/End: Original strand, 19686820 - 19686858
Alignment:
| Q |
226 |
gttacaaaaattttagggtgaggggatggtgccccagtc |
264 |
Q |
| |
|
|||||| ||||||||||||||||||||| |||||||||| |
|
|
| T |
19686820 |
gttacagaaattttagggtgaggggatgatgccccagtc |
19686858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 5)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 226 - 268
Target Start/End: Complemental strand, 17064462 - 17064420
Alignment:
| Q |
226 |
gttacaaaaattttagggtgaggggatggtgccccagtccaag |
268 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17064462 |
gttacaaaaattttagggtgaggggatggtgccccagtccaag |
17064420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 231 - 268
Target Start/End: Original strand, 20983001 - 20983038
Alignment:
| Q |
231 |
aaaaattttagggtgaggggatggtgccccagtccaag |
268 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
20983001 |
aaaatttttagggtgaggggatggtgccccagtccaag |
20983038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 232 - 268
Target Start/End: Complemental strand, 37976683 - 37976647
Alignment:
| Q |
232 |
aaaattttagggtgaggggatggtgccccagtccaag |
268 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||| |
|
|
| T |
37976683 |
aaaattttagggtgaggggatggtgccccagttcaag |
37976647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 226 - 268
Target Start/End: Original strand, 35237052 - 35237094
Alignment:
| Q |
226 |
gttacaaaaattttagggtgaggggatggtgccccagtccaag |
268 |
Q |
| |
|
|||||| ||||||||| |||||||||||||||| ||||||||| |
|
|
| T |
35237052 |
gttacagaaattttagagtgaggggatggtgcctcagtccaag |
35237094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 232 - 268
Target Start/End: Complemental strand, 41910957 - 41910921
Alignment:
| Q |
232 |
aaaattttagggtgaggggatggtgccccagtccaag |
268 |
Q |
| |
|
||||||||| |||||||||||||||||||||| |||| |
|
|
| T |
41910957 |
aaaattttaaggtgaggggatggtgccccagttcaag |
41910921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 16)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 226 - 268
Target Start/End: Complemental strand, 2570340 - 2570298
Alignment:
| Q |
226 |
gttacaaaaattttagggtgaggggatggtgccccagtccaag |
268 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2570340 |
gttacaaaaattttagggtgaggggatggtgccccagtccaag |
2570298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 226 - 268
Target Start/End: Complemental strand, 55231826 - 55231784
Alignment:
| Q |
226 |
gttacaaaaattttagggtgaggggatggtgccccagtccaag |
268 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55231826 |
gttacaaaaattttagggtgaggggatggtgccccagtccaag |
55231784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 226 - 268
Target Start/End: Original strand, 46494391 - 46494433
Alignment:
| Q |
226 |
gttacaaaaattttagggtgaggggatggtgccccagtccaag |
268 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
46494391 |
gttacaaaatttttagggtgaggggatggtgccccagtccaag |
46494433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 226 - 263
Target Start/End: Original strand, 51713958 - 51713995
Alignment:
| Q |
226 |
gttacaaaaattttagggtgaggggatggtgccccagt |
263 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51713958 |
gttacaaaaattttagggtgaggggatggtgccccagt |
51713995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 232 - 267
Target Start/End: Original strand, 7173584 - 7173619
Alignment:
| Q |
232 |
aaaattttagggtgaggggatggtgccccagtccaa |
267 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
7173584 |
aaaattttagggtgaggggatggtgccccagtccaa |
7173619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 233 - 268
Target Start/End: Complemental strand, 36192673 - 36192638
Alignment:
| Q |
233 |
aaattttagggtgaggggatggtgccccagtccaag |
268 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
36192673 |
aaattttagggtgaggggatggtgccccagtccaag |
36192638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 226 - 268
Target Start/End: Complemental strand, 29576554 - 29576512
Alignment:
| Q |
226 |
gttacaaaaattttagggtgaggggatggtgccccagtccaag |
268 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| |||||| |
|
|
| T |
29576554 |
gttacaaaaattttagggtgagggggtggtgccccaatccaag |
29576512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 226 - 268
Target Start/End: Complemental strand, 51066632 - 51066590
Alignment:
| Q |
226 |
gttacaaaaattttagggtgaggggatggtgccccagtccaag |
268 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
51066632 |
gttacaaattttttagggtgaggggatggtgccccagtccaag |
51066590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 236 - 276
Target Start/End: Original strand, 2294719 - 2294759
Alignment:
| Q |
236 |
ttttagggtgaggggatggtgccccagtccaagacagtgaa |
276 |
Q |
| |
|
||||||||||||||||||||||||||||| ||| ||||||| |
|
|
| T |
2294719 |
ttttagggtgaggggatggtgccccagtctaaggcagtgaa |
2294759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 232 - 268
Target Start/End: Original strand, 22304090 - 22304126
Alignment:
| Q |
232 |
aaaattttagggtgaggggatggtgccccagtccaag |
268 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| |
|
|
| T |
22304090 |
aaaattttagggtgagaggatggtgccccagtccaag |
22304126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 232 - 264
Target Start/End: Original strand, 30970383 - 30970415
Alignment:
| Q |
232 |
aaaattttagggtgaggggatggtgccccagtc |
264 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
30970383 |
aaaattttagggtgaggggatggtgccccagtc |
30970415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 226 - 272
Target Start/End: Original strand, 4080545 - 4080591
Alignment:
| Q |
226 |
gttacaaaaattttagggtgaggggatggtgccccagtccaagacag |
272 |
Q |
| |
|
||||||||||||||| || ||||||||||||| ||| |||||||||| |
|
|
| T |
4080545 |
gttacaaaaattttaaggcgaggggatggtgctccaatccaagacag |
4080591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 226 - 268
Target Start/End: Complemental strand, 32139303 - 32139261
Alignment:
| Q |
226 |
gttacaaaaattttagggtgaggggatggtgccccagtccaag |
268 |
Q |
| |
|
|||| ||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
32139303 |
gttataaaaaatttagggtgaagggatggtgccccagtccaag |
32139261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 226 - 268
Target Start/End: Original strand, 47626986 - 47627028
Alignment:
| Q |
226 |
gttacaaaaattttagggtgaggggatggtgccccagtccaag |
268 |
Q |
| |
|
||||||||||||||||||||||| ||||||| |||||||||| |
|
|
| T |
47626986 |
gttacaaaaattttagggtgaggagatggtgttccagtccaag |
47627028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 226 - 268
Target Start/End: Complemental strand, 50905887 - 50905845
Alignment:
| Q |
226 |
gttacaaaaattttagggtgaggggatggtgccccagtccaag |
268 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| |||| |
|
|
| T |
50905887 |
gttacaaaaattttagggtgaaaggatggtgccccagttcaag |
50905845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 236 - 268
Target Start/End: Complemental strand, 51066283 - 51066251
Alignment:
| Q |
236 |
ttttagggtgaggggatggtgccccagtccaag |
268 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| |
|
|
| T |
51066283 |
ttttagggtgaggggatggtgccccagttcaag |
51066251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 21)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 226 - 268
Target Start/End: Complemental strand, 50823837 - 50823795
Alignment:
| Q |
226 |
gttacaaaaattttagggtgaggggatggtgccccagtccaag |
268 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50823837 |
gttacaaaaattttagggtgaggggatggtgccccagtccaag |
50823795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 226 - 268
Target Start/End: Original strand, 50852023 - 50852065
Alignment:
| Q |
226 |
gttacaaaaattttagggtgaggggatggtgccccagtccaag |
268 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50852023 |
gttacaaaaattttagggtgaggggatggtgccccagtccaag |
50852065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 232 - 276
Target Start/End: Complemental strand, 7417931 - 7417887
Alignment:
| Q |
232 |
aaaattttagggtgaggggatggtgccccagtccaagacagtgaa |
276 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
7417931 |
aaaattttagggtgaggggatggtgccccagtccaaggcagtgaa |
7417887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 226 - 268
Target Start/End: Complemental strand, 773716 - 773674
Alignment:
| Q |
226 |
gttacaaaaattttagggtgaggggatggtgccccagtccaag |
268 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
773716 |
gttacaaaaattctagggtgaggggatggtgccccagtccaag |
773674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 226 - 272
Target Start/End: Original strand, 19872476 - 19872522
Alignment:
| Q |
226 |
gttacaaaaattttagggtgaggggatggtgccccagtccaagacag |
272 |
Q |
| |
|
|||| |||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
19872476 |
gttataaaaattttaggatgaggggatggtgccccagtccaagacag |
19872522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 226 - 268
Target Start/End: Original strand, 25910659 - 25910701
Alignment:
| Q |
226 |
gttacaaaaattttagggtgaggggatggtgccccagtccaag |
268 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
25910659 |
gttacaaaaattttagggtgaggggatggtgcctcagtccaag |
25910701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 232 - 268
Target Start/End: Complemental strand, 8400988 - 8400952
Alignment:
| Q |
232 |
aaaattttagggtgaggggatggtgccccagtccaag |
268 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8400988 |
aaaattttagggtgaggggatggtgccccagtccaag |
8400952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 232 - 268
Target Start/End: Original strand, 37330606 - 37330642
Alignment:
| Q |
232 |
aaaattttagggtgaggggatggtgccccagtccaag |
268 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37330606 |
aaaattttagggtgaggggatggtgccccagtccaag |
37330642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 232 - 268
Target Start/End: Complemental strand, 52545454 - 52545418
Alignment:
| Q |
232 |
aaaattttagggtgaggggatggtgccccagtccaag |
268 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52545454 |
aaaattttagggtgaggggatggtgccccagtccaag |
52545418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 226 - 268
Target Start/End: Original strand, 43334047 - 43334089
Alignment:
| Q |
226 |
gttacaaaaattttagggtgaggggatggtgccccagtccaag |
268 |
Q |
| |
|
||||||||| |||||||||||||||||||| |||||||||||| |
|
|
| T |
43334047 |
gttacaaaatttttagggtgaggggatggtaccccagtccaag |
43334089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 232 - 268
Target Start/End: Complemental strand, 22856020 - 22855984
Alignment:
| Q |
232 |
aaaattttagggtgaggggatggtgccccagtccaag |
268 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| |
|
|
| T |
22856020 |
aaaattttagggtgaggggatggtgctccagtccaag |
22855984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 236 - 268
Target Start/End: Complemental strand, 34824685 - 34824653
Alignment:
| Q |
236 |
ttttagggtgaggggatggtgccccagtccaag |
268 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
34824685 |
ttttagggtgaggggatggtgccccagtccaag |
34824653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 232 - 268
Target Start/End: Complemental strand, 35198898 - 35198862
Alignment:
| Q |
232 |
aaaattttagggtgaggggatggtgccccagtccaag |
268 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| |
|
|
| T |
35198898 |
aaaattttagggtgaggggatggtgctccagtccaag |
35198862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 236 - 268
Target Start/End: Complemental strand, 55468129 - 55468097
Alignment:
| Q |
236 |
ttttagggtgaggggatggtgccccagtccaag |
268 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
55468129 |
ttttagggtgaggggatggtgccccagtccaag |
55468097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 233 - 264
Target Start/End: Original strand, 22371729 - 22371760
Alignment:
| Q |
233 |
aaattttagggtgaggggatggtgccccagtc |
264 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
22371729 |
aaattttagggtgaggggatggtgccccagtc |
22371760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 233 - 268
Target Start/End: Original strand, 30534902 - 30534937
Alignment:
| Q |
233 |
aaattttagggtgaggggatggtgccccagtccaag |
268 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||| |
|
|
| T |
30534902 |
aaattttagggtgaggggatggtaccccagtccaag |
30534937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 226 - 272
Target Start/End: Original strand, 358935 - 358981
Alignment:
| Q |
226 |
gttacaaaaattttagggtgaggggatggtgccccagtccaagacag |
272 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| |||| ||||||| |
|
|
| T |
358935 |
gttacataaattttagggtgaggggatggtgccatagtctaagacag |
358981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 226 - 268
Target Start/End: Original strand, 39438822 - 39438863
Alignment:
| Q |
226 |
gttacaaaaattttagggtgaggggatggtgccccagtccaag |
268 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
39438822 |
gttacaaaaattttagggtga-gggatggtgccccagttcaag |
39438863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 231 - 272
Target Start/End: Original strand, 30203652 - 30203693
Alignment:
| Q |
231 |
aaaaattttagggtgaggggatggtgccccagtccaagacag |
272 |
Q |
| |
|
|||| |||||| ||||||||||||||||||||| |||||||| |
|
|
| T |
30203652 |
aaaatttttagagtgaggggatggtgccccagttcaagacag |
30203693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 232 - 261
Target Start/End: Original strand, 37454743 - 37454772
Alignment:
| Q |
232 |
aaaattttagggtgaggggatggtgcccca |
261 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
37454743 |
aaaattttagggtgaggggatggtgcccca |
37454772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 232 - 268
Target Start/End: Complemental strand, 25589347 - 25589311
Alignment:
| Q |
232 |
aaaattttagggtgaggggatggtgccccagtccaag |
268 |
Q |
| |
|
|||||||||||||||||||| |||||||| ||||||| |
|
|
| T |
25589347 |
aaaattttagggtgaggggagggtgcccccgtccaag |
25589311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 20)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 226 - 268
Target Start/End: Original strand, 2357069 - 2357111
Alignment:
| Q |
226 |
gttacaaaaattttagggtgaggggatggtgccccagtccaag |
268 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2357069 |
gttacaaaaattttagggtgaggggatggtgccccagtccaag |
2357111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 226 - 268
Target Start/End: Original strand, 2754044 - 2754086
Alignment:
| Q |
226 |
gttacaaaaattttagggtgaggggatggtgccccagtccaag |
268 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2754044 |
gttacaaaaattttagggtgaggggatggtgccccagtccaag |
2754086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 226 - 268
Target Start/End: Original strand, 10745225 - 10745267
Alignment:
| Q |
226 |
gttacaaaaattttagggtgaggggatggtgccccagtccaag |
268 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10745225 |
gttacaaaaattttagggtgaggggatggtgccccagtccaag |
10745267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 226 - 268
Target Start/End: Complemental strand, 17136526 - 17136484
Alignment:
| Q |
226 |
gttacaaaaattttagggtgaggggatggtgccccagtccaag |
268 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17136526 |
gttacaaaaattttagggtgaggggatggtgccccagtccaag |
17136484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 226 - 268
Target Start/End: Original strand, 558432 - 558474
Alignment:
| Q |
226 |
gttacaaaaattttagggtgaggggatggtgccccagtccaag |
268 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
558432 |
gttacaaaaattttagggtgaggggatggtgccccattccaag |
558474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 226 - 268
Target Start/End: Complemental strand, 21638036 - 21637994
Alignment:
| Q |
226 |
gttacaaaaattttagggtgaggggatggtgccccagtccaag |
268 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
21638036 |
gttacaaaaattttagggtgaggggatggtgccctagtccaag |
21637994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 226 - 268
Target Start/End: Original strand, 25987654 - 25987696
Alignment:
| Q |
226 |
gttacaaaaattttagggtgaggggatggtgccccagtccaag |
268 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
25987654 |
gttacaaaaattttagggtgaggggatggtgccccagaccaag |
25987696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 226 - 268
Target Start/End: Complemental strand, 26690293 - 26690251
Alignment:
| Q |
226 |
gttacaaaaattttagggtgaggggatggtgccccagtccaag |
268 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
26690293 |
gttacaaaaattttagggtgaggggatggtgcctcagtccaag |
26690251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 226 - 268
Target Start/End: Original strand, 36380125 - 36380167
Alignment:
| Q |
226 |
gttacaaaaattttagggtgaggggatggtgccccagtccaag |
268 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
36380125 |
gttacaaaaattttagggtgaggggatggtgcctcagtccaag |
36380167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 226 - 268
Target Start/End: Original strand, 45136963 - 45137005
Alignment:
| Q |
226 |
gttacaaaaattttagggtgaggggatggtgccccagtccaag |
268 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
45136963 |
gttacaaaaattttagggtgaagggatggtgccccagtccaag |
45137005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 232 - 268
Target Start/End: Original strand, 2098825 - 2098861
Alignment:
| Q |
232 |
aaaattttagggtgaggggatggtgccccagtccaag |
268 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2098825 |
aaaattttagggtgaggggatggtgccccagtccaag |
2098861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 226 - 268
Target Start/End: Complemental strand, 5039559 - 5039517
Alignment:
| Q |
226 |
gttacaaaaattttagggtgaggggatggtgccccagtccaag |
268 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| |||||||| |
|
|
| T |
5039559 |
gttacaaaaattttagagtgaggggatggtgccctagtccaag |
5039517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 226 - 268
Target Start/End: Complemental strand, 40156179 - 40156137
Alignment:
| Q |
226 |
gttacaaaaattttagggtgaggggatggtgccccagtccaag |
268 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||| |||| |
|
|
| T |
40156179 |
gttacaaaaattttatggtgaggggatggtgccccagttcaag |
40156137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 232 - 268
Target Start/End: Complemental strand, 33066723 - 33066687
Alignment:
| Q |
232 |
aaaattttagggtgaggggatggtgccccagtccaag |
268 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
33066723 |
aaaattttaggatgaggggatggtgccccagtccaag |
33066687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 232 - 268
Target Start/End: Original strand, 36836328 - 36836364
Alignment:
| Q |
232 |
aaaattttagggtgaggggatggtgccccagtccaag |
268 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
36836328 |
aaaattttaaggtgaggggatggtgccccagtccaag |
36836364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 232 - 268
Target Start/End: Complemental strand, 44650526 - 44650490
Alignment:
| Q |
232 |
aaaattttagggtgaggggatggtgccccagtccaag |
268 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
44650526 |
aaaattttagggtgaggggatggtgccccggtccaag |
44650490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 233 - 268
Target Start/End: Original strand, 13047156 - 13047191
Alignment:
| Q |
233 |
aaattttagggtgaggggatggtgccccagtccaag |
268 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| |
|
|
| T |
13047156 |
aaattttagggtgaggggatggtgctccagtccaag |
13047191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 226 - 268
Target Start/End: Original strand, 7860139 - 7860181
Alignment:
| Q |
226 |
gttacaaaaattttagggtgaggggatggtgccccagtccaag |
268 |
Q |
| |
|
|||||||||||||||||| ||||||||| |||| ||||||||| |
|
|
| T |
7860139 |
gttacaaaaattttagggagaggggatgatgcctcagtccaag |
7860181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 227 - 264
Target Start/End: Complemental strand, 3201019 - 3200982
Alignment:
| Q |
227 |
ttacaaaaattttagggtgaggggatggtgccccagtc |
264 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||||||| |
|
|
| T |
3201019 |
ttacaaaaattttagggcgaggagatggtgccccagtc |
3200982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 236 - 272
Target Start/End: Original strand, 4553561 - 4553597
Alignment:
| Q |
236 |
ttttagggtgaggggatggtgccccagtccaagacag |
272 |
Q |
| |
|
|||||| |||||||||||||||||||||| ||||||| |
|
|
| T |
4553561 |
ttttagagtgaggggatggtgccccagtctaagacag |
4553597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 14)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 226 - 268
Target Start/End: Complemental strand, 12025320 - 12025278
Alignment:
| Q |
226 |
gttacaaaaattttagggtgaggggatggtgccccagtccaag |
268 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
12025320 |
gttacaaaaattttagggtgagggggtggtgccccagtccaag |
12025278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 226 - 268
Target Start/End: Original strand, 14498072 - 14498114
Alignment:
| Q |
226 |
gttacaaaaattttagggtgaggggatggtgccccagtccaag |
268 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
14498072 |
gttacaaaaattttagggtgaggggatggcgccccagtccaag |
14498114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 226 - 268
Target Start/End: Complemental strand, 20014597 - 20014555
Alignment:
| Q |
226 |
gttacaaaaattttagggtgaggggatggtgccccagtccaag |
268 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
20014597 |
gttacaaaaattttagggtgaggggatggtgcctcagtccaag |
20014555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 226 - 268
Target Start/End: Complemental strand, 22024242 - 22024200
Alignment:
| Q |
226 |
gttacaaaaattttagggtgaggggatggtgccccagtccaag |
268 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
22024242 |
gttacataaattttagggtgaggggatggtgccccagtccaag |
22024200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 234 - 272
Target Start/End: Original strand, 30850841 - 30850879
Alignment:
| Q |
234 |
aattttagggtgaggggatggtgccccagtccaagacag |
272 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30850841 |
aattttagggtgaggggatggtgccccagtccaagacag |
30850879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 226 - 268
Target Start/End: Original strand, 33762533 - 33762575
Alignment:
| Q |
226 |
gttacaaaaattttagggtgaggggatggtgccccagtccaag |
268 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
33762533 |
gttacaaaaattttagggtgaggggatgatgccccagtccaag |
33762575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 230 - 267
Target Start/End: Complemental strand, 45324141 - 45324104
Alignment:
| Q |
230 |
caaaaattttagggtgaggggatggtgccccagtccaa |
267 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45324141 |
caaaaattttagggtgaggggatggtgccccagtccaa |
45324104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 227 - 272
Target Start/End: Complemental strand, 4573517 - 4573472
Alignment:
| Q |
227 |
ttacaaaaattttagggtgaggggatggtgccccagtccaagacag |
272 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| |||||||| |||| |
|
|
| T |
4573517 |
ttacaaaaattttagggtgaggggatagtgcctcagtccaaaacag |
4573472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 226 - 267
Target Start/End: Complemental strand, 17015259 - 17015218
Alignment:
| Q |
226 |
gttacaaaaattttagggtgaggggatggtgccccagtccaa |
267 |
Q |
| |
|
|||||| |||||||||| |||||||||||||||||||||||| |
|
|
| T |
17015259 |
gttacataaattttaggatgaggggatggtgccccagtccaa |
17015218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 226 - 267
Target Start/End: Complemental strand, 35618114 - 35618073
Alignment:
| Q |
226 |
gttacaaaaattttagggtgaggggatggtgccccagtccaa |
267 |
Q |
| |
|
||||||||| |||||||||||||||||||| ||||||||||| |
|
|
| T |
35618114 |
gttacaaaatttttagggtgaggggatggtaccccagtccaa |
35618073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 236 - 268
Target Start/End: Original strand, 30054445 - 30054477
Alignment:
| Q |
236 |
ttttagggtgaggggatggtgccccagtccaag |
268 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
30054445 |
ttttagggtgaggggatggtgccccagtccaag |
30054477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 234 - 268
Target Start/End: Original strand, 30370061 - 30370095
Alignment:
| Q |
234 |
aattttagggtgaggggatggtgccccagtccaag |
268 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||| |
|
|
| T |
30370061 |
aattttaaggtgaggggatggtgccccagtccaag |
30370095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 226 - 268
Target Start/End: Original strand, 33763247 - 33763289
Alignment:
| Q |
226 |
gttacaaaaattttagggtgaggggatggtgccccagtccaag |
268 |
Q |
| |
|
|||||| ||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
33763247 |
gttacagaaattttagggtgaggggatgatgccccagttcaag |
33763289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 236 - 268
Target Start/End: Complemental strand, 21090244 - 21090212
Alignment:
| Q |
236 |
ttttagggtgaggggatggtgccccagtccaag |
268 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| |
|
|
| T |
21090244 |
ttttagagtgaggggatggtgccccagtccaag |
21090212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0021 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: scaffold0021
Description:
Target: scaffold0021; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 232 - 268
Target Start/End: Original strand, 107691 - 107726
Alignment:
| Q |
232 |
aaaattttagggtgaggggatggtgccccagtccaag |
268 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
107691 |
aaaattttagg-tgaggggatggtgccccagtccaag |
107726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University