View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12804_high_4 (Length: 300)
Name: NF12804_high_4
Description: NF12804
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12804_high_4 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 283; Significance: 1e-158; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 283; E-Value: 1e-158
Query Start/End: Original strand, 12 - 298
Target Start/End: Original strand, 41094625 - 41094911
Alignment:
| Q |
12 |
atagggtgaatattgaggaatctaggagaatggaggggaaggccgtatgtgctctttttagggtagagtggctttgggattttatttgagagttatcgtc |
111 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41094625 |
atagggtgagtattgaggaatctaggagaatggaggggaaggccgtatgtgctctttttagggtagagtggctttgggattttatttgagagttatcgtc |
41094724 |
T |
|
| Q |
112 |
atgattagctgtttgacttctctactagggcatacatgctccaccgtgtaccattttggtagacaagatccacaaatcttccatatgccaaatatctact |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41094725 |
atgattagctgtttgacttctctactagggcatacatgctccaccgtgtaccattttggtagacaagatccacaaatcttccatatgccaaatatctact |
41094824 |
T |
|
| Q |
212 |
gttgtttaggaatttgtcaaattgcatagatattcttaggagatggtgcaaacatgagatgagatagctcagaggatgcatgcatga |
298 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41094825 |
gttgtttaggaatttgtcaaattgcatagatattcttaggagatggtgcaaacatgagatgagatagctcagaggatgcatgcatga |
41094911 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University