View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12806_high_4 (Length: 298)
Name: NF12806_high_4
Description: NF12806
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12806_high_4 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 160; Significance: 3e-85; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 160; E-Value: 3e-85
Query Start/End: Original strand, 19 - 201
Target Start/End: Complemental strand, 5249492 - 5249316
Alignment:
| Q |
19 |
ggttgatggtctagtctttgacatggcatggtgttgaggcctttgaggggacataccgtactatgatatgggtggcattgatattgatatatgttacatt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5249492 |
ggttgatggtctagtctttgacatggcatggtgttgaggcctttgaggggacataccgtactatgatatgggtggcattgatattgatatatgttacatt |
5249393 |
T |
|
| Q |
119 |
cattaacattggtatgttaatgtttatgcattttgtaaactttatattataaattataagactttagtgaaacgggaaacctg |
201 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5249392 |
cattaacattggta------tgtttatgcattttgtaaactttatattataaattataagactttagtgaaacgggaaacctg |
5249316 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 230 - 280
Target Start/End: Complemental strand, 5249287 - 5249237
Alignment:
| Q |
230 |
gacacacaacctttgcttctaattggttgacggcgcctctcacactcactc |
280 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5249287 |
gacacacaacctttgcttctaattggttgacggcgcctctcacactcactc |
5249237 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University