View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12806_high_6 (Length: 250)
Name: NF12806_high_6
Description: NF12806
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12806_high_6 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 105; Significance: 1e-52; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 106 - 242
Target Start/End: Original strand, 43184111 - 43184247
Alignment:
| Q |
106 |
tcgacacgtgtgaggaaaattgttgcgagnnnnnnnnatggcacacgcatccattgtgaatttgtaattgatttgttgagcagggaatagaaacgaggca |
205 |
Q |
| |
|
||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43184111 |
tcgacacgtgtgaagaaaattgttgcgagttttttttatggcacacgcatccattgtgaatttgtaattgatttgttgagcagggaatagaaacgaggca |
43184210 |
T |
|
| Q |
206 |
agtaattgtctgtactcgcactcacctgccctatgct |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||| |
|
|
| T |
43184211 |
agtaattgtctgtactcgcactcacctgccttatgct |
43184247 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 1 - 40
Target Start/End: Original strand, 43184006 - 43184045
Alignment:
| Q |
1 |
tgaatcgtccaaaggttccataacggagcagtgattaagt |
40 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43184006 |
tgaatcgtccaaaggttccataacggagcagtgattaagt |
43184045 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University